Cibicidoides variabilis

Order “Rotaliida” > Family “Incertae sedis” > Genus “Cibicidoides

Original description Orbigny, A. D’, 1826, Annales du Museum d’Histoire Naturelles, Paris, 7, 1-275
Further reference Schweizer, M., Fontaine, D., Pawlowski, J., 2011, Revue de Micropaléontologie, 54, 175-182 (617 KB)

General description

The coiling is regular in the first whorl (juvenile stages), but becomes completely chaotic during the later growth stages with coarse porosity on both sides.

Representative pictures

Cibicidoides variabilis

Specimens

Specimen 6200

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6200
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on January 2006
Habitat pebble beach
Depth intertidal
Location Seno Otway, Patagonia
Latitude, Longitude -52.33, -71.44

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6200 | taxon:892010 | 1 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6200 | taxon:892010 | 2 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgt

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6200 | taxon:892010 | 3 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

Specimen 6201

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6201
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on January 2006
Habitat pebble beach
Depth intertidal
Location Seno Otway, Patagonia
Latitude, Longitude -52.33, -71.44

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6201 | taxon:892010 | 1 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcacgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatatttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6201 | taxon:892010 | 2 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgcgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttgattcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

Specimen 6205

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6205
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on January 2006
Habitat pebble beach
Depth intertidal
Location Seno Otway, Patagonia
Latitude, Longitude -52.33, -71.44

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6205 | taxon:892010 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA gacagtttaaataagtgttaaatgctacattaaacttcatcacatatcacgcatagatgattttgtttacagtagtaacaatttccgcgtgaatcacccatcacagtgaatcactgaaattacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaattttcattgaaacacccgctcgcgggcatcgttcggtgattttttttattttgttgcatcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacatgcgttacaccgtgacaatttctttatggataactcagggaaagtttggctaatacgtacgagtaatttaccacacacacacacacacactcaacaattcaaaatttttttgtattgctgtgtatcaactactactcagcactcaatggtaaactttggctgccctcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgtcttcggacacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacatacaagttttaatgacagacattataacactttcattttttctgttacattacacacatatatatccttgttcgttgtattcagcatctataatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgcggacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagt

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6205 | taxon:892010 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA tgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaaatttattctgcacacctatggaaacttaaacgaacagtgtgtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgatcctg

See sequence on NCBI

Specimen 6206

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6206
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on January 2006
Habitat pebble beach
Depth intertidal
Location Seno Otway, Patagonia
Latitude, Longitude -52.33, -71.44

Barcode sequence

SSU partial

>Cibicidoides variabilis | genomic DNA | 6206 | taxon:892010 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA tggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaaggatca

See sequence on NCBI

Specimen 6484

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6484
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6484 | taxon:892010 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA aacccgacagtttaaataagtgttaaatgctacattaaacttcatcacatatcacgcatagatgattttgtttacagtagtaacaatttcagcgtgtatcacccatcacagtgaatcactgaaattacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaattttcattgaaacacccgctcgcgggcatcgttcggtgattttttttattttgttgcatcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacatgcgttacaccgtgacaatttctttatggataactcagggaaagtttggctaatacgtacgagtaatttaccacacacacacacacacactcaacaattcaaaatttttttgtattgctgtgtatcaactactactcagcactcaatggtaaactttggctgcctcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacatacaagttttaatgacagacattataacactttcattttttctgttacattacacacatatatatccttgttcgttgtattcagcatttataatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaattgcactgtt

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6484 | taxon:892010 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA gcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcctcggaaagcgcgcgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgtcatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatgaaactaaacg

See sequence on NCBI

Specimen 6485

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6485
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6485 | taxon:892010 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA gccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacattaaacttcatcacatatcacgcatagatgattttgtttacagtagtaacaatttcagcgtgtatcacccatcacagtgaatcactgaaattacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaattttcattgaaacacccgctcgcgggcatcgttcggtgattttttttattttgttgcatcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacatgcgttacaccgtgacaatttctttatggataactcagggaaagtttggctaatacgtacgagtaatttaccacacacacacacacacactcaacaattcaaaatttttttgtattgctgtgtatcaactactactcagcactcaatggtaaactttggctgcctcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacatacaagttttaatgacagacattataacactttcattttttctgttacattacacacatatatatccttgttcgttgtattcagcatttataatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcgtgtatctgaattccaagtggagggcaagtctggtgc

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6485 | taxon:892010 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA tgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatactagttcgctctaattatgttaaatatgctagtcctttcttgattatgtgataagtggtgcatggccgttcttatttcgtggagtgatctgtcggcttaattgcttttcactaatggcctataaatttacgtgtgttgcggcactttgacccctttcttctcaaagcgcgtgtcttatgttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgccygtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaagg

See sequence on NCBI

Specimen 6486

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6486
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6486 | taxon:892010 | PCR_primers=fwd_name: sA, rev_name: s6 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaatgctacattaaacttcatcacatatcacgcatagatgattttgtttacagtagtaacaatttcagcgtgaatcacccatcacagtgaatcactgaaattacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaattttcattgaaacacccgctcgcgggcatcgttcggtgattttttttattttgttgcatcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacatgcgttacaccgtgacaatttctttatggataactcagggaaagtttggctaatacgtacgagtaatttaccacacacacacacacacactcaacaattcaaaatttttttgtattgctgtgtatcaactactactcagcactcaatggtaaactttggctgcctcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgtcttcggacacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacatacaagttttaatgacagacattataacactttcattttttctgttacattacacacatatatatccttgttcgttgtattcagcatctataatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcgtgtatctgaatttcaagtggagggcaagtctggt

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6486 | taxon:892010 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaactaaacgaaa

See sequence on NCBI

Specimen 6592

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides variabilis
Isolate number 6592
Collector Delia Fontaine
Identifier Delia Fontaine
Collected on March 2006
Habitat Seaweed
Depth 10m
Location Punta Huinay, Patagonia
Latitude, Longitude -42.22, -72.25

Barcode sequences

SSU partial

>Cibicidoides variabilis | genomic DNA | 6592 | taxon:892010 | 1 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttaccttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggkggggacagaccattgttaattgttggtctcggtyttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI

SSU partial

>Cibicidoides variabilis | genomic DNA | 6592 | taxon:892010 | 2 | PCR_primers=fwd_name: s14, rev_name: sB | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgacatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtc

See sequence on NCBI