Cibicidoides pachyderma

Order “Rotaliida” > Family “Incertae sedis” > Genus “Cibicidoides

Original description Rzehak, A., 1886, Naturf. Ver., Brünn, Verh., Brünn, 24, 87
Further reference Schweizer, M., Pawlowski, J., Kouwenhoven, T., van der Zwaan, B., 2009, J. For. Res., 39, 300-315 (6.48 MB)

General description

Convex spiral side with some additional calcite on it that is more developed than the convex to flat umbilical side. Angular subacute periphery in profile.

Representative pictures

Cibicidoides pachyderma_C86 Cibicidoides pachyderma_C87

Specimens

Specimen C196

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides pachyderma
Isolate number C196
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on October 2003
Habitat soft sediment
Location Portugal, Nazaré Canyon
Latitude, Longitude 39.385, -9.1699

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgtcatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacaggccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaagacatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Cibicides pachyderma | genomic DNA | C196 | taxon:349560 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttcaatgctacattaaacttatcacatatcacgcatagatgattttgtttacagtagtaacaatttcagcgtgaatcacccatcacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaattttcattgaaacacccgctcgcgggcagctcggtgaatttttttattttgttgcatcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtactttaccacacacacacacacacacacacacacactcaacaattcaaaatttttttgtattgctgtgcatcaactactactcagcactcagtggtaaactttggccgcctcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgtcttcggacacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgaccccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcaaattgtatttacatgcgttaacaatttacaacattacaagttttaatgacagacattataacactttcattttttctgttatattacacacatatatatccttgttcgttgtattcagcatccataatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgctcgtgtatctgaatttcaagtggagggcaagtctggtgcnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgagctgcaaatacgaatgaatttctcattctgtttgaagttttacgctttaatcactcgtgattttttgcgttcgacgcctgttaaaatttatacaattttttctgttgtattaaatttttcatttacacggcacaaatattttctgccgcatacattttattacatcacacacacacacacacacacgttgtaataataataaacgtatgcatttcaacgctgaaaacttttgtattcaaacactcgtttaaaatttattctccttttcaacactgtgaacaaatcagagtgtatcaaacatgtcnttttgaatgtgcattgaatgtcttatcatgagatgttgcactttctgcgtwaaaaatttttattgcctgtttacagcgctgtattcatttttagcattacacacacacacagcacgcacatgttacatgccacgtaaataatttttctatacatacgataaatttttttaacggttaaaaatgtcgataggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactytttgtgattatatttttatgcgacgtagcttacgctgaaatttttttgcattacacacatacacacactgcatcaaattttttttttggcgcttcgctgcagcatatacatatatatacactttacaatgaagaacgaaggttgggggatcaaagagggtcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttttattaaattgcaaatttcctcagcctacaaaataacttggcttgagctcgtatttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttatattttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcacactacccgcagcatatgtcttcgggcattttgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgtcatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacaggccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaagacatcggtaggtgaacct

See sequence on NCBI

Specimen C86

Cibicidoides pachyderma_C86
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides pachyderma
Isolate number C86
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on October 2003
Habitat soft sediment
Depth 338m
Location Portugal, Nazaré Canyon
Latitude, Longitude 39.3891, -9.1471

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgtcatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Cibicides pachyderma | genomic DNA | C86 | taxon:349560 | small subunit ribosomal RNA catgcaagtggttatattaacccgacagtttaaataagtgttcaatgctacattaaacttatcacatatcacgcatagatgattttgtttacagtagtaacaatttcagcgtgaatcacccatcacagtgaatcactgaaatttacccaatatcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtaataaaaattttcattgaaacacccgctcgcgggcagctcggtgaatttttttattttgttgcatcacgcatacaaaattttttgatttctctgtatcgcttattcttaaggacatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtactttaccacacacacacacacacacacacacactcaacaattcaaaatttttttgtattgctgtgtatcaactactactcagcactcartggtaaactttggctgcctcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgtgtcttcggacacttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctaataccctacaatcaaattgtatttacatgcgttaacaatttacaacatacaagttttaatgacagacattataacactttcattttttctgttacattacacacatatatatccttgttcgttgtattcagcatccataatattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcgtgtatctgaatttcaagcggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaatacgaatgaatttctcattctgtttgaagttttacgctttaatcactcgtgattttttgcgttcgacgcctgttaaaatttatacaattttttctgttgtattaaatttttcatttacacggcacgaatattttctgccgcatacattttattacaccacacacacacacacacacacgttgtaataataaacgtatgcatttcaacgctgaaaacttttgtattcraacactcgtttaraatttattctccttttcaacactgtgaacaaatcagtgtgtatcaaacatgtckttttgaatgtgcattgaatgtcttatcatgggatgttgcactttctgcgttaaaaatttttattgcctgtttacagcgctgtattcatttttagcattacacacacacacagcacgcacatgttacrtgccacgtaaataatttttctatacatacgataaatttttttaacggttaaaartgtcgatggrgatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatatttttatgcgacgtagcttacgctgaaatttttttgcattacacacacacacacactgcatcaaatttttttttggcgcttcgctgcagcatatacatatatatacactttacaatgaagaacgaaggttgggggatcaaagagaatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatcttttattaaattgcaaatttcctcagcctacaaaataacttggcttgagctcgtatttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttatattttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgtcacactacccgcagcatatgtcttcgggcattttgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcntactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgtgttcgcacgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgtcatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Specimen C87

Cibicidoides pachyderma_C87
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides pachyderma
Isolate number C87
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on October 2003
Habitat soft sediment
Depth 338m
Location Portugal, Nazaré Canyon
Latitude, Longitude 39.3891, -9.1471

Barcode sequence

SSU partial

>Cibicides pachyderma x kullenbergi | genomic DNA | C87 | T. Kouwenhoven C87 (UniGE) | taxon:378218 | small subunit ribosomal RNA caagcttgatatgcaagcgaacctaatgmgkgatcgcacgtattatgttaaatatgctagtyctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctttcttcggaaagcgcgtgtcttagtttgctttgctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgtcatttttatggcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcacttcggtgctttaaatgtgtatttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttagcacacatatatacggcgtctatacccgggttaccttgttgtaacttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagaatttattctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcag

See sequence on NCBI