Cibicidoides wuellerstorfi

Order “Rotaliida” > Family “Incertae sedis” > Genus “Cibicidoides

Original description Schwager, C., 1866, Geol. Theil, Bd. 2, Abt. 2, 268
Further reference Schweizer, M., Pawlowski, J., Kouwenhoven, T., J., Guiard, J., van der Zwaan, B., 2008, Mar. Micropal., 66 (1.09 MB)

General description

Low trochospiral test with flattened evolute spiral side and slightly convex umbilical side.

Representative pictures

Cibicidoides wuellerstorfi_C184

Specimens

Specimen C184

Cibicidoides Wuellerstorfi_C184
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides wuellerstorfi
Isolate number C184
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on October 2003
Habitat soft sediment
Depth 2774m
Location Portugal, Setubal Canyon
Latitude, Longitude 38.1202, -9.1699

Barcode sequence

SSU partial

>Cibicides wuellerstorfi | genomic DNA | C184 | taxon:325266 | small subunit ribosomal RNA aagggcaccatcaagacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatactttgcttcggcattgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgtatcgcacttcgacccctttctttaattagaaagcgcgtgtcttagtttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttattcattttttaatgttcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgtgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI