Globobulimina turgida

Order “Rotaliida” > Family “Incertae sedis” > Genus “Globobulimina

Original description Bailey, J., W., 1851, Smithsonian Inst. Contr. Knowledge, Washington, D. C., USA, 2, p.12
Description Höglund, H., 1947, Zoologiska Bidrag fran Uppsala, 26

General description

Ovoidal inflated test, smooth with some small dentate projections at the apex.

Representative pictures

Globobulimina turgida, Norway, Oslofjord Globobulimina turgida, Norway, Oslofjord Globobulimina turgida, Norway, Oslofjord

Specimens

Specimen 12268

Globobulimina turgida_12268 Globobulimina turgida_12268
Species Rotaliida > Incertae sedis > Globobulimina > Globobulimina turgida
Isolate number 12268
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Habitat soft sediment
Depth 157m
Location Oslofjord, Norway

Barcode sequences

SSU partial

>FR754376 AAGGGCACCACAAGAACGCGTGGAGCNTTTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCGGACACACTGAGGATTGACAGGCAATATTAATAATTTATTTTTTCTGTGTGTCACCACATCAGTAATATATTTTATTATGTTAAATATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATCTGTCTGCTTAATTGCGTTTCACTAAGGGCCTAGAAATTTACGTATGTTGCGACACTTTGACCCCTCCTTGTGTGCGTGCGTCTTTGTTTGTTTAGCTCATACAAATAGGTCCTGAAAGCAACGAACGTGACCGCAACCTCTTGTTGCTTTCGTATATATATGATACATGTATTTTATTATACTAGTATTAATATATTATACATATTGCTATATATAATATTATGTGTCATTGCCACTAACCTGGTAGTGTCTACATATTTTGTATATAATTTATGCACAGAAAGCTTTTTAAACTAGAGGGACCGCTGTTACTTTCTTAAACCAGAGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGATTATTGCAGTGAGCATCTCATTTTATTATTCACACCGCATGCGCGAGACCATTTATTCTCTCTTCGCGAGTGTTTTAAATGTGTATCTCTGCGCGCGGTAAAGCCTACTTCGAAAGTAAGCGGGTAATCAATTAGAAGTAATGATTTCCTATATTTTATTGTACTGAATTTTTTTGGTATAGTAATTCTGCACACATATATACGGCATCTTTACCCGGGTAGCCTTGTTGTTACTTTTTGTGCGTATCGATGTTTTTTTCCGTATGTGCGATTGTCAATTCATGGTGGGGACAGACCATTGTTAATTGTTGGTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTTGGTTCAACAAACCACCCGGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCGCTCTTACCGATGGACTTCTCTGTGAGTTTGAGGGACTGGGAACGCATGTAATAAATTTACGTTTATTTATGCACACCTATGGAAACNTAAACGAACAGTGTGGTCTAAAGGAAAG

See sequence on NCBI

SSU partial

>FR754377 AAGGGCACCACAAGAACGCGTGGAGCATGTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCGGACACACTGAGGATTGACAGGCAATATTAATAATTTATTTTTTCTGTGTGTCACCACATCAGTAATATATTTTATTATGTTAAATATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGTTCGTGGAGTGATCTGTCTGCTTAATTGCGTTTCACTAAGGGCCTAGAAATTTACGTATGTTGCGACACTTTGACCCCTCCTTGTGTGCGTGCGTCTTTGTTTGTTTAGCTCATACAAATAGGTCCTGAAAGCAACGAACGTGACCGCAACCTCTTGTTGCTTTCGTATATATATGATACATGTATTTTATTATACTAGTATTAATATATTATACATATTGCTATATATAATATTATGTGTCATTGCCACTAACCTGGTAGTGTCTACATATTTTGTATATAATTTATGCACAGAAAGCTTTTTAAACTAGAGGGACCGCTGTTACTTTCTTAAACCAGAGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGCTGCACACGTGCTACAATGATTATTGCAGTGAGCATCTCATTTTATTATTCACACCGCATGCGCGAGACCATTTATTCTCTCTTCGCGAGTGTTTTAAATGTGTATCTCTGCGCGCGGTAAAGCCTACTTCGAAAGTAAGCGGGTAATCAATTAGAAGTAATGATTTCCTATATTTTATTGTACTGAATTTTTTTGGTATAGTAATTCTGCACACATATATACGGCATCTTTACCCGGGTAGCCTTGTTGTTACTTTTTGTGCGTATCGATGTTTTTTTCCGTATGTGCGATTGTCAATTCATGGTGGGGACAGACCATTGTTAATTGTTGGTCTCGGTCTTAACTAGGAATGCCTTGTACGGGTCTTTGGTTCAACAAACCACCCGGAATACGCCCCTGCCCTTTGTACACACCGCCCGTCGCTCTTACCGATGGACTTCTCTGTGAGTTTGAGGGACTGGGAACGCATGTAATAAATTTACGTTTATTTATGCACACCTATGGAAACTTAAACGAACAGTGTGGTCTAAAGGAAAGAGAAGTCGAACAAGGCA

See sequence on NCBI

Specimen 12270

Globobulimina turgida_12270
Species Rotaliida > Incertae sedis > Globobulimina > Globobulimina turgida
Isolate number 12270
Collector Roberto Sierra
Identifier Elisabeth Alve
Collected on September 2010
Habitat soft sediment
Depth 157m
Location Oslofjord, Norway

Barcode sequence

SSU partial

>FR754378 AAGGGCACCACAAGAACGCGTGGAGCTTTTGGCTTAATTTGACTCAACGCGGGAAATCTTACCGGGTCCG GACACACTGAGGATTGACAGGCAATATTAATAATTTATTTTTTCTGTGTGTTTTAACGCACATCAGTAAT ATATTTTATTATGTTAAATATGCTAGTCCTTTCATGATTATGTGATAGGTGGTGCATGGCCGTTCTTAGT TCGTGGAGTGATCTGTCTGCTTAATTGCGTTTCACTAAGGGCCTAGAAATCTACGTATGTTGCGACACTT TGACCCCTCCTTGTGTGCGTGCGTCTTTGTTTGTTTAGCTCATACAAATAGGTCCTGAAAGCAACGAACG TGACCGCAACCTCTTGTTGCTTTCGTATATATATGATACATGTATTTTATTATACTAGTATAATATATTA TACATACTGCATACATAATATTATGTGTCATTGTCACTAACTAAAAATATAAGACTTGTCTTTTTTTTTT ATGTTGTGTAGTGTCTTTACATATTTTGTATATCTTTATGCACAGAAAGCCTTTTAAACTAGAGGGACCG CTGTTACTTTCTTAAACCAGAGGAAGGTTGCGGCAATAACAGGTCTGTGATGCCCTTAGATGTTCCGGGC TGCACACGTGCTACAATGATTATTGCAGTGAGCATCTCATTTTATTATTCACACCGCATGCGCGAGACCA TTTATTCTCTCTTCGCGAGTGTTTTAAATGTGTATCTCTGCGCGCGGTAAAGCCTACTTCGAAAGTAAGC GGGTAATCAATTAGAAGTAATGATTTCCTATATTTTATTGTATCATTTTTTTGGTATAGTAATTCTGCAC ACATATATACGGCATCTTTACCCGGGTAGCCTTGTTGTTACTTTTTGTGCGTATCGATGTTTTTTTCCGT ATGTGCGATTGTCAATTCATGGTGGGGACAGACCATTGTTAATTGTTGGTCTCGGTCTTAACTAGGAATG CCTTGTACGGGTCTTTGGTTCAACAAACCACCCGGAATACGTCCCTGCCCTTTGTACACACCGCCCGTCG CTCTTACCGATGGACTTCTCTGTGAGTTTGAGGGACTGGGAACGCATGTAATAAATTTTATTTATTTATG CACACCTATGGAAAC

See sequence on NCBI