Hyalinea baltica

Order “Rotaliida” > Family “Incertae sedis” > Genus “Hyalinea

Original description Schröter, J., S., 1783, 1, Halle. J. J. Gebauer
Further reference Schweizer, M., Pawlowski, J., Kouwenhoven, T., J., Guiard, J., van der Zwaan, B., 2008, Mar. Micropal., 66 (1.09 MB)

General description

Discoidal test consisting of two whorls in adult specimens, nearly planispiral and semievolute on both sides.

Representative pictures

Hyalinea baltica Hyalinea baltica Hyalinea baltica Hyalinea baltica

Specimens

Specimen 3604

Species Rotaliida > Incertae sedis > Hyalinea > Hyalinea baltica
Isolate number 3604
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on May 2002
Location Oslofjord, Norway

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatatcataatttatagtttatttacttcggtacttattctaatattatgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggtccataaatttatgtatgttgcgacgcattgacccctcatttaattatgagcgctgcgtctttgtcgtttagctcatgcgattggatcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacttttatatgctgcgtacagttaatcctgtatgtattgtactgtaattgtgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattcatacatcgcatgcgcgagtccatttattctgtgctttcgggcactgttttaaatgtgtatctctgcgcgcgataaagcctacttcgaaagtaagtgggtaatcaattagaagtaatgatttccttaatttatagcacacatatatacggcagctttacccagccagccttgttgctggatcttgtgtgtattgctgctttttccgtatgtgcaattgtcaattcatggtgggggcagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttcagggactggagttattttcaaccctatggaaactgaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatccagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Hyalinea balthica | genomic DNA | 3604 | taxon:203415 | small subunit ribosomal RNA ttaagccatgcaagtggttatatcaacccgacagtttaaataagtgttaaattgctacacattataaacgcaacattattcatctacatacagtgaatactttttacacagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctattaaatattatgctatagcataaactgaactcacgcagtataatcgtatgctacaactacacacaaaaaaatgacatacgcgttctgtggaaggttagtgacctgcatagtaaatattaaaattaaaattgtttacaagctacgtacagtatctacgcagttgataccacacaacaactcactgcattttacgatctgtgcaagctgttttacaatgatttctctgtatcgcgttatacttacaagaacatgcgttacaccgtgacaaatttctttatggataactcagggaaagtttggctaatacgtacgagtatttttaaaacacactgtaattgtgtaacataattatctctctacaggcgagtgcataacagcgcttaacggcagaatgaattattattcagcactttctacaacaacatactactcagcactcaatggtaagctttggttttttacgttcgcgtaattaccagtttaaagtttaactgcaacatgagagacattgagcacgcacgtggtggggtaatttattcgtttcgccacatctacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaaattacatagtattaatacaacaatttacaataaaacaagtttataaaacacgcacattataacacattatttcattctgtcctacagaatatcatacatatccttgttcgttgtaactcacgtaatttattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactacaatacatagaataataataaattctataagctagtttcgtacaaaaagtagcaatatatttgcagtacttactgttacagacactacatcacacacgaaacaacactgtgtctttcgtagctgcaagcctgtaaatagctatttttttacgtttcgacgcaccgtactaaattaatattattttattcatatagcttacggcaaccttgtaaataattacacacaaccaaatccattatttacgcggcagaattatactcgaattttttattctcctttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgccttaattcaaacgcgttagaaatatttagctgtacgacagacatcacacacaaaccttacaatcactctgcgtactgttaatattatctaacacagtgccagtgacacatgaataatattttatatttctaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattaactattcgtttgcagactctatgcgaagctttttaaacgctgctatacacacaaacattttcagcacgtactatagctattaacatacgagtcaaactcgcgaatacttatataacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttacattaaattgcaaatttcctcagcctacaaaattactctggcttgagctcgtatttcgatacgctcgcctaatcaattttcgtacggtctctgatggacgtttcgtttaaaaatattttttgcgtgtaagcattgtattttatctttgaaacataagattatactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcatcatgtcattgctacccgcagtgtatatcttcgggtatttcatctgtcgtgcgtagctgacactttttcgatgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatatcataatttatagtttatttacttcggtacttattctaatattatgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggtccataaatttatgtatgttgcgacgcattgacccctcatttaattatgagcgctgcgtctttgtcgtttagctcatgcgattggatcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacttttatatgctgcgtacagttaatcctgtatgtattgtactgtaattgtgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattcatacatcgcatgcgcgagtccatttattctgtgctttcgggcactgttttaaatgtgtatctctgcgcgcgataaagcctacttcgaaagtaagtgggtaatcaattagaagtaatgatttccttaatttatagcacacatatatacggcagctttacccagccagccttgttgctggatcttgtgtgtattgctgctttttccgtatgtgcaattgtcaattcatggtgggggcagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttcagggactggagttattttcaaccctatggaaactgaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatccagtaggtgaacct

See sequence on NCBI