Epistominella exigua

Order “Rotaliida” > Family “Incertae sedis” > Genus “Epistominella

Original description Brady, H. B., 1884, Zoology, 9
Further reference Lecroq, B., Gooday, A., J., Pawlowski, J., 2009, Zootaxa, 2096, 23-32 (681 KB)

General description

Usually 5 chambers in the last whorl, last chamber often assumes a triangular shape in fully grown individuals.

Representative pictures

Epistominella exigua

Specimens

Specimen 3623

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 3623
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on May 2002
Habitat soft sediment
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Epistominella exigua | genomic DNA | 3623 | J. Pawlowski 3623 (UniGE) | taxon:349561 | small subunit ribosomal RNA gattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgcgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgc

See sequence on NCBI

Specimen 5127

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 5127
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Epistominella exigua | genomic DNA | 5127 | seawater, depth:4654m | taxon:349561 | Antarctica:Weddell Sea | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA tttgactcacgcgggaanncttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgcgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 5191

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 5191
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Habitat soft sediment
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Epistominella exigua | genomic DNA | 5191 | seawater, depth:4803m | taxon:349561 | Antarctica:Weddell Sea | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA atttgactcacgcgggaaancttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgcgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 5222

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 5222
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on February 2005
Habitat soft sediment
Location Southern Ocean, Weddell Sea

Barcode sequence

SSU partial

>Epistominella exigua | genomic DNA | 5222 | taxon:349561 | small subunit ribosomal RNA caagtggttatattaacccgacagtttaaataagtgttaaatgctacattaaacttatacacactcacgcacacacaccatacgattttgtttacggtagtaacaatttcagcgtgaatcacttcttacacgcagtgaatcactggaatttacacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgtcattttaaaaatttccttattcggaacacctgctcgcaggcttacgggtggatttttttatatcgacttttgtcgtgcatacccacgcatttcaaaattcattttgatttctctgtatcgcttattctctaaggacatgcgttacaccgtgacaattttcttttatggataactcagggaaagtttggctaatacgtacgagtacatataccacacacacacacacacgatacaaaatttattttgttttgctgcgtgtatcgacacaccacacacacacacacacacttactactcagcactcaatggtaaactttggccgcgttcgcgcagtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgttccttcgggagcttcacatcacgctgagcagactttgcgaagtttacttcgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatctatttataaattgtaacattaccatgcgttaacaatttacaacataacaagtttattacacatatagcactatatttttttctgtcacacagagaagacatccttgttcgttgtttattcagcatataagctattattttatattagttttttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttcgtgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaaatttgaatgaattctcgtatccattctattttttgttatagttttacgcattatcaaattcacgtttgtattttgcgttcgacgctcgttaaaaatttacacacacacacttttttttttacgcggcactcgaatttttaccgtagcgtatatacgtacattctacacacacacacttatttacgtatatatgcactcacgcggtaattatttgagagaactatatcactcgcttaaaatttattctcctttcaacactgtgaacaaatcaaagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcacttccgccttaaagaaaattattgcaattttttcgccacacacacaccatgcgtacatgttatatatatttcgcagccacgtaaaattctgttattttctttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagcggtgaaatgcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatgcgtataagagtcacacgtatatttttttacacacacacacacgcacaaaaattttatacgctctctctccattacgcatcaatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttttcattaaattgcaaatttcctcagcctacaaaatgacttggcttgagctcgtatttttatacgctcgcctaacttttttcgtatggtctcgatggacgtttcatttatatttttttgcgtgtaagcattatgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcatactgcccgcagcgtataccctcgggtatttcgtctgtcgtgtgcagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgcgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaagggaagagaagtcgaacaaggca

See sequence on NCBI

Specimen 6929

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 6929
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2006
Habitat soft sediment
Depth 1905m
Location Pacific Ocean, off Japan
Latitude, Longitude 33.51, 136.29

Barcode sequences

SSU partial

>Epistominella exigua | genomic DNA | P6929-22 | taxon:349561 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcgtgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtagagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Epistominella exigua | genomic DNA | P6929-21 | taxon:349561 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggcccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccatatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7180

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 7180
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2006
Habitat soft sediment
Depth 1905m
Location Pacific Ocean, off Japan
Latitude, Longitude 33.51, 136.29

Barcode sequences

SSU partial

>Epistominella exigua | genomic DNA | P7180-12 | taxon:349561 | small subunit ribosomal RNA taatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtct

See sequence on NCBI

SSU partial

>Epistominella exigua | genomic DNA | P7180-11 | taxon:349561 | small subunit ribosomal RNA aatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacggacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgnacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcgtacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaac

See sequence on NCBI

Specimen 7565

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 7565
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on October 2006
Habitat soft sediment
Depth 1990m
Location Pacific Ocean, off Japan
Latitude, Longitude 33.49, 137.08

Barcode sequences

SSU partial

>Epistominella exigua | genomic DNA | P7565-21 | taxon:349561 | small subunit ribosomal RNA tcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcgtgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaac

See sequence on NCBI

SSU partial

>Epistominella exigua | genomic DNA | P7565-22 | taxon:349561 | small subunit ribosomal RNA aacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggcggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttnttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgnggtctaaaggaaagagaagtcgtaacaaggc

See sequence on NCBI

Specimen 7566

Species Rotaliida > Incertae sedis > Epistominella > Epistominella exigua
Isolate number 7566
Collector Jan Pawlowski
Identifier Jan Pawlowski
Habitat soft sediment
Depth 1905m
Location Pacific Ocean, off Japan
Latitude, Longitude 33.51, 136.29

Barcode sequences

SSU partial

>Epistominella exigua | genomic DNA | P7566-33 | taxon:349561 | small subunit ribosomal RNA gactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaagtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacagtgtggtctaaaggaaag

See sequence on NCBI

SSU partial

>Epistominella exigua | genomic DNA | P7566-31 | taxon:349561 | small subunit ribosomal RNA actcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatttcgtatttcggtacgttattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcggcactttgacccctctttttttattaaaagagcgcgtgtcttagtttgcttagctcacacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgatatactcttctgagtacttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatacgcgagtccatttattcactctcgggtgctttaaatgtgtatctctgcgagcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtttatacccgggctgccttgttgtagcttttgtgcgtatagatgtttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcagattttattatcagcacacctatggaaacttaaacgaacanngnggtctaaaggaaagagnagtcgtaacaaggc

See sequence on NCBI