Rosalina sp. 1

Order “Rotaliida” > Family “Rosalidae” > Genus “Rosalina

Original description of genus Orbigny, A. D’, 1826, Annales du Museum d’Histoire Naturelles, Paris, 7, 1-275
Description of genus Loeblich, A., J., R., Tappan, H., 1988, vol.1-2, Van Nostrand, Reinhold, New York

General description

Trochospiral test with rapidly enlarging chambers, central aperture on umbilical side.

Representative pictures

Rosalina sp. 1, spiral side, Germany, North Sea, Langeoog Rosalina sp. 1, spiral side, Germany, North Sea, Langeoog

Specimens

Specimen 12971

Rosalina sp. 1_12971
Species Rotaliida > Rosalidae > Rosalina > Rosalina sp. 1
Isolate number 12971
Collector Heike Bender
Identifier Heike Bender
Collected on June 1984
Location North Sea, Langeoog, Germany

Barcode sequences

SSU partial

>Rosalina sp. 12971 | genomic DNA | 12971 | taxon:987146 | 20 | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgatgattgacaggcaatatcagcgcatctctgatgctgctgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtctcactaaggaactatatttcttatgtatgttgtcagcgcattgacccctcaactgctacaattcttaactgaattgacttttgctgcgcgtgtctttgattctcgtctggctcatacgattagttcctgaaagcaacgaacgtgaccgcaacctcttgttgccttcaaatcataatacatgcactcatttggatgaatttcatttgtgtgcatacgggaggcttttctaaactagagggaccgctgttatcttctttagaccagaggaaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttacttaatacatcgcaagcgcgagtccgtttgttctttgtttcagttcatgctgttcagagcttcaaatgagtatctctgcgcgcgataaagcctgctttgaaagtttagtgggtaatcaattagaagtaatgatttcctaaatttatcgcacttatatgtacggcgtctttacccagctggccttttgtgccagaattcgtgtgtatcgacgattgatttcttataatcaattgccattcttacggtaccgtacgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacagaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtcaatctaaacttcgctttaganctttaagacctatggaaacttaaacgaacagtgtgntnnnnnnnaaagagaagtcgaacaaggcaaagg

See sequence on NCBI

SSU partial

>Rosalina sp. 12971 | genomic DNA | 12971 | taxon:987146 | 21 | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgagnattgacaggcaatatcagcgcatctctgatgctgctgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaggaactatatttcttatgtatgttgtcagcgcattgacccctcaactgctacaattcttaattgaattgacttttgctgcgcgtgtctttgattctcgtctggctcatacgattagttcctgaaagcaacgaacgtgaccgcaacctcttgttgccttcaaatcataatacatgcactcatttgatgaatttcatttgtgtgcatacggaggctttctaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacagggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttacttaatacatcgcaagcgcgagtccgtttgttctttgtttcagttcatgctgttcagagcttcaaatgagtatctctgcgcgcgataaagcctgctttgaaagtttagtgggtaatcaatnananataatgatttcctaaatttatcgcacttatatgtacggcgtctttacccagctggccttttgtgccagaattcgtgtgtatcgacgattgatttcttataatcaattgcctttcttacggtaccgtacgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacagaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggtcaannnnaacttcgctttagatctttaagacctatggaaacttaaacgaacagtgtggtnnnnnnnaagagaagtcgaacaaggca

See sequence on NCBI

Specimen R1

Species Rotaliida > Rosalidae > Rosalina > Rosalina sp. 1
Isolate number R1
Collector Heike Bender
Identifier Heike Bender
Collected on June 1984
Location North Sea, Langeoog, Germany

Barcode sequence

SSU partial

>Rosalina sp. R1 | genomic DNA | R1 | taxon:944409 | North Sea | Sep-2010 | Christoph Hemleben | 18S rRNA | 18S rRNA | 18S ribosomal RNA tgctgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaggaactatatttcttatgtatgttgtcagcgcattgacccctcaactgctacaattcttaattgaattgacttttgctgcgcgtgtctttgattctcgtctggctcatacgattagttcctgaaagcaacgaacgtgaccgcaacctcttgttgccttcaaatcataatacatgcactcatttgatgaatttcatttgtgtgcatacggaggctttctaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttacttaatacatcgcaagcgcgagtccgtttgttctttgtttcagttcatgctgttcagagcttcaaatgagtatctctgcgcgcgataaagcctgctttgaaagtttagtgggtaatcaattagaagtaatgatttcctaaatttatcgcacttatatgtacggcgtctttacccagctggccttttgtgccagaattcgtgtgtatcgacgattgatttcttataatcaattgcctttcttacggtaccgtacgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacagaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctctt

See sequence on NCBI

Specimen R2

Species Rotaliida > Rosalidae > Rosalina > Rosalina sp. 1
Isolate number R2
Collector Heike Bender
Identifier Heike Bender
Collected on June 1984
Location North Sea, Langeoog, Germany

Barcode sequence

SSU partial

>Rosalina sp. R2 | genomic DNA | R2 | taxon:944408 | North Sea | Sep-2010 | Christoph Hemleben | 18S rRNA | 18S rRNA | 18S ribosomal RNA tgacaggcaatatcagcgcatctctgatgctgctgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaggaactatatttcttatgtatgttgtcagcgcattgacccctcaactgctacaattcttaattgaattgacttttgctgcgcgtgtctttgattctcgtctggctcatacgattagttcctgaaagcaacgaacgtgaccgcaacctcttgttgccttcaaatcataatacatgcactcatttgatgaatttcatttgtgtgcatacggaggctttctaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttacttaatacatcgcaagcgcgagtccgtttgttctttgtttcagttcatgctgttcagagcttcaaatgagtatctctgcgcgcgataaagcctgctttgaaagtttagtgggtaatcaattagaagtaatgatttcctaaatttatcgcacttatatgtacggcgtctttacccagctggccttttgtgccagaattcgtgtgtatcgacgattgatttcttataatcaattgcctttcttacggtaccgtacgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacagaccacccggaa

See sequence on NCBI