Globocassidulina biora

Order “Rotaliida” > Family “Cassidulinidae” > Genus “Globocassidulina

Original description Crespin,I., 1960, Tohoku Univ. Sci. Repts. Sendai, Japan, 4, 28-29
Further reference Majewski, W., Pawlowski, J., 2010, Antarctic Science, 22, 271-281 (452 KB)

General description

Biconvex test, almost circular in side view, broadly rounded periphery. Two parallel slitlike apertures parallel to the basal suture of the ultimate chamber.

Representative pictures

Globocassidulina biora

Specimens

Specimen 7902

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7902
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7902 | taxon:1051365 | 15 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaattttttgcactttcgggtgtaattttttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccctgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7905

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7905
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7905 | taxon:1051365 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA tattgactcacgcgggaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccanaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcnnttcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgaacaaggcaa

See sequence on NCBI

Specimen 7907

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7907
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequences

SSU partial

>Globocassidulina biora | genomic DNA | 7907 | taxon:1051365 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaattttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaatcgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Globocassidulina biora | genomic DNA | 7907 | taxon:1051365 | 28 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgcctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcctaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccaatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7909

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7909
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 30m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequences

SSU partial

>Globocassidulina biora | genomic DNA | 7909 | taxon:1051365 | 31 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggtccaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Globocassidulina biora | genomic DNA | 7909 | taxon:1051365 | 33 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtacgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgwacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaagccagaggaaggttgcggcaataacaggtctgtgatgcccctagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7931

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7931
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Location Antarctica, King George Island, Admiralty Bay

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7931 | taxon:1051365 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA tattgactcacgcgggaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccanaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcg

See sequence on NCBI

Specimen 7962

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7962
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 35m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequences

SSU partial

>Globocassidulina biora | genomic DNA | 7962 | taxon:1051365 | 21 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttttgcactttcgggtgtaatttttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaagccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgcgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Globocassidulina biora | genomic DNA | 7962 | taxon:1051365 | 23 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatataattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaattttttgcactttcgggtgtaatttttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcaataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7963

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7963
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 35m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7963 | taxon:1051365 | 39 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctctgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaagagagctttctaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

Specimen 7964

Species Rotaliida > Cassidulinidae > Globocassidulina > Globocassidulina biora
Isolate number 7964
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on March 2007
Habitat soft sediment
Depth 35m
Location Antarctica, King George Island, Admiralty Bay
Latitude, Longitude -62.806, -58.819

Barcode sequence

SSU partial

>Globocassidulina biora | genomic DNA | 7964 | taxon:1051365 | 1 | Antarctica:King George Island, Admiralty Bay | 18S rRNA | 18S rRNA | 18S ribosomal RNA tattgactcacgcgggaatcttaccgggtccggacacactgaggattgacaggcaatattataaagtaaatctttgtgtcattcgtggctcaagcgatttttttatatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactattgggcttatataattacgtatgctgttaacgctttgacccctttctacggattgcgcgtgtctttgtccgttcgacacatacaattaagccctgaaagcaacgaacgtgaccgcaacctcttgttgctctccatttcgatttataccagaatcgtcgcgtattaatttcttaattttaatttttgcactttcgggtgtaattttttttatgactgtatttttttacgttaanagagctttctaaactagagggaccgctgttactttcttaaaccanaggaaggttgcggcaataacaggtctgtgatgcccttanatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacatcgcatgcgcgagtccatttattcatcacttcggtgttgctttaaatgtgcacctctgcgcgcgataaagcctacttcgagagcaagtgggtaatcaattagaagtaatgatttccttttttttctgcacgcatatatatggcacttatacccgggtagccttgttgttacttctgtgcgtatcagtgatacttttgtgtttaccacaatcgtatattaccatatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggatctttggttcaacaaaccatccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggtatatgatgccacagttttttttattcgtaaaaaaaattgtcatcccactatagaaacttaaacgaacagtggggtctaaaggaaagagaagtc

See sequence on NCBI