Baculogypsina sphaerulata

Order “Rotaliida” > Family “Calcarinidae” > Genus “Baculogypsina

Original description Parker, W. K., Jones, T., R., 1860, Ann. Mag. Nat. Hist., 29-40
Further reference Hohenegger, J., 2004, J. For. Res., 34, 9-33

General description

Lenticular thick-walled test with prominent radial spines. Brownish colour in living individuals due to diatom symbionts

Representative pictures

Baculogypsina sphaerulata, Japan, Sesoko Baculogypsina sphaerulata, Australia, Lizard Island Baculogypsina sphaerulata, Japan Baculogypsina sphaerulata, Japan Baculogypsina sphaerulata, Japan Baculogypsina sphaerulata, Japan Baculogypsina sphaerulata, Japan

Specimens

Specimen 334

Species Rotaliida > Calcarinidae > Baculogypsina > Baculogypsina sphaerulata
Isolate number 334
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on December 1996
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtgttatcccacataatcagtgggtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagtttgtggagtgatctgtctgcttaattgcgtttcactgaaggctcatattatatgcacggcattctttgacccctcattaataatgagcgttgtgtcttagtcttttgcttagcatctgggccttggaagcaacgaacgtgaccgcaacctcttgttgcctctcataaccatataaaagaggcctatttaaataaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatacacatacacaccgcatgcgcgagtccactttttcacgaaggtgtgtgtctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccatacagcacacatatatacggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacc

See sequence on NCBI

Other sequence

SSU total

>Baculogypsina sphaerulata | genomic DNA | 334 | marine sediment sample | taxon:212455 | Japan:Okinawa, Sesoko | Dec-1996 | 18S rRNA | 18S rRNA | 18S ribosomal RNA | unknown ctcaaagattaagccatgcaagtggttatatattaacccgacagtttaaataagtgttaaagtgctatacacactcacacgtgataatcacatacatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcaccctacacacggataactcagggaaagtttggctaatacgtacgacacacacacacacacatgacattactcagcactcaatggttagcttagcaggcaacatgagagacattgagcacgcactgatatcatacactgtatcacgctgagcagactttgcgaagtttacttctgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaggagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatggtaacacatttatctgtcacgcacacacacacacatccttgtcacgtactgaggcagtgacaagctgtaacggttgagtataaaatatgacgagtgtctggcattgccgctccttctgggagcttggcattattgccgacgctttgtatgctcaattggaatgcggtgagtttaagcaactcagaacctttgtacatatcacatgtgcatannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttactgaatgtgcattgaatgtctatcatgggatggtgcactattcagcccgttgaacacacacacacaataattctcagtcacacaacggttatgaatgtcgatggagatagtggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgtctcactcacacacacacacacactcacacatacacacacagagtgatcgacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattctttttataagattgcaagcactcctcaacctacaaaatgacttggcttgagcctgtaacttttgttgttacgctcgccagactattttcgtacggtctcgatggacgtttcattttattatctatgcgtgtaagcatttgtatgtatcacacatactgcgtgcacttgattttcggagctttgcgctcaaattctggtgagatgtaagcactatgtttatctgttaaccgcagtatgaacaatatttggtgtgacgcacgctttaggcacgcgcttactgcagaaatgtctgagacattgatttccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtgttatcccacataatcagtgggtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagtttgtggagtgatctgtctgcttaattgcgtttcactgaaggctcatattatatgcacggcattctttgacccctcattaataatgagcgttgtgtcttagtcttttgcttagcatctgggccttggaagcaacgaacgtgaccgcaacctcttgttgcctctcataaccatataaaagaggcctatttaaataaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatacacatacacaccgcatgcgcgagtccactttttcacgaaggtgtgtgtctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccatacagcacacatatatacggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacc

See sequence on NCBI