Baculogypsinoides spinosus

Order “Rotaliida” > Family “Calcarinidae” > Genus “Baculogypsinoides

Original description Yabe, H., Hanzawa, S., 1930, Scie. Rep. Tôhoku University, Sendai, ser. 2, Geology., 14, 1-46
Further reference Hohenegger, J., 2004, J. For. Res., 34, 9-33

General description

Globular test with three to four thick protuding spines. Brownish colour in living individuals caused by diatom symbionts.

Representative pictures

Baculogypsinoides spinosus

Specimens

Specimen 339

Species Rotaliida > Calcarinidae > Baculogypsinoides > Baculogypsinoides spinosus
Isolate number 339
Collector Johann Hohenegger
Identifier Johann Hohenegger
Collected on December 1996
Location Japan, Sesoko, Okinawa

Barcode sequence

SSU partial

>Baculogypsinoides spinosus | genomic DNA | 339 | taxon:203395 | 36 | Japan: Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccgaacacactgaggattgacaggtagtatcatatcacacacttttgtgttgtgatatgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaaggccatattttaacgatgtattgcggcgctttgacccctcattaatttgagcgttgtgtcttagtctttgcttagcatcatgcatttgggccttgaaagcaacgaacgtgaccgcaacctcttgttgcctctcataccaaatgcactacactcatgtgttatgcacaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattacacaccgcatgcgcgagtctgattattcactctcgagtgctttaatcatgtagctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttattcgcacacatatatacggcatctttacccggcctgccttgttgcagtgtctctgtgtgtattgatgtgatatattacatatcaattatccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggattgcgttatttctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI