Robertina arctica

Order “Robertinida” > Family “Robertinidae” > Genus “Robertina

Original description Orbigny, A. D`., 1846, Paris: Gide et Comp.
Description Höglund, H., 1947, Zoologiska Bidrag fran Uppsala, 26

General description

Oval test, about twice as long as broad, initial end bluntly pointed, distal end rounded.

Representative pictures

Robertina arctica

Specimens

Specimen 2632

Species Robertinida > Robertinidae > Robertina > Robertina arctica
Isolate number 2632
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on August 2001
Location Svalbard

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaaaatggagtctcgcatttatttgcgtgttcttctttttatgtcaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgnggagtgatctgtctgcttaattgcgtttcactaagagttctaaacttaatgtgtattgcagcggtttcattgacccctgtcaatttattggcggtgttgttgtctttgtttcttgtctgcttacactactgagctctgaaagcaacgaacgtgaccgcagcctcttgttgcctttcgtaaaacaatcgcttttcattaagcttttgatcaaaaaaggctcattttttaaactagagggaccgctgtatcttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttgatacatcgcttgcgcgagtcacactgtttattcagtgttgttctttgcgcgcgataaagcctgcttcgaaagttagtgggtaatcaattagaagtaatgatttcctaattcttcgcacaataatatactgcattcattaccgaccttgccttgtgtttggttctgagttacatgagtgttgaggctctctgagttctctttcagtatgtgcaaatgtcaactcccggtggggacaaaccattgttaattgttggtttcggtctcaactaggaatgccttgtactggtctttggttcaacaaaccaccaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaattgtttgtctacattcacttgtattcaaatcctctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Robertina arctica | genomic DNA | taxon:551669 | 18S ribosomal RNA rbrtnactcaaagattaagccatgcaagtggttataataacccgatagtttaaataagtgttataaattttgagaatcgcttcaaaaattgtactttaaacacacctcttttgacgattcagagcaaaatttcggatgataacttatgcaactgcagacagctgcttaatacagtcacacttgtcttgactttggcactcgatcaaatcatctttgattcatacactcactgggccagaactaacacttacagtcacctgtttttgtcttctgggttccctttattgaattatcgatgtttttgtttgatacgacaaaaagatttctctgtagcggttcttatattttttacgaaatatttcgacgttacatcgtgcattttacttttcggataactcagggaaagtttggctaatacgtacgagcatctttaatcttacacacccacaccactctctgcacaacgagaaaagatcttttactcagcacttattggtaaatgtttgatgcgctttcgagtgcatctttcaacatttaaaagcaacatgagagacaataagtacgcaggattgggcatttcttgtcctttccatacgctgagcagactttgcgaagttcacttttgcgaagcaagtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgatagtaccctacaatatgtaataccatcattcacaaaattttttaacacacaattttctctgtcaactttaatccttgtcagactgaatcaattaattaaccttgtgaattcattttctcatattattttactgaggcagtgacaagctgtaacggttgagtataataatgacgagtgtctgacattgccgcctgcttctgtaggcttggcagtctgtcgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttgtaaaaagcattgttcttgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaactttaaaaacacaatttcaggtttcttcggatctcgttctgatgtaatacgcacacgtacccacgtcagcaacgttctttgcggattcttgtttttgatttttatttaccaaagtttgtagcacaagacactttgtctttttctagatgaagtgtgcttgtacgacgctgttaattgtattcggtcttgaatgacaaatatgatttgcagtctgatacacaaacgaaataaagatcttaccatttttatcgttttcaacactgtgaacaaatcagagtgtatcaaacatgtcttttctaaatgtgcattgaatgttccatcatgggatgctgcacttttaacactttcttttcccatgttttgctaaccactcacactgtagctttacaaccgggtaaaacatgtgaaggcatgtgctatacttcatactgtcttttgaaaagaaaacagttataaatgtcgatggggatagttggagtcaagagtactgttgggcgagcggtgaaatgcattgaccctagcaagactaccaaaagcgaaagcacttgactaggctatactctttgtgatgtcagtgtttgaagatacacgctactcgcgtatcatggttatttgcggagcaattaacgttagttgcgtattgccaactttcgagagattgttagagtgaacggcaacggatactgttgttgttatcgcatttattcattgatcgcaatttgcacttcattcatctggttacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttttaaatattaattgcaaatgccctcaacctacaaaatattgaatattttcgttgcttgagctagtgtctttattgatacgctcgctttgaatttatttgttttcgtacggtctcgatggacgtttcgattaaaaaatctaattttttgcgtgtatgcattttgactttatcttcattgataattcattgcgtgcacttgattttcggagctttgcgctcaaattttggtgagatgtaagcactgtgtcattctacacgagaactttccgttcaatttattgttcggacttgcttcatcgtttgtagtctgatattttttcaaataggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcactattaaaaatggagtctcgcatttatttgcgtgttcttctttttatgtcaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgnggagtgatctgtctgcttaattgcgtttcactaagagttctaaacttaatgtgtattgcagcggtttcattgacccctgtcaatttattggcggtgttgttgtctttgtttcttgtctgcttacactactgagctctgaaagcaacgaacgtgaccgcagcctcttgttgcctttcgtaaaacaatcgcttttcattaagcttttgatcaaaaaaggctcattttttaaactagagggaccgctgtatcttctttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttgatacatcgcttgcgcgagtcacactgtttattcagtgttgttctttgcgcgcgataaagcctgcttcgaaagttagtgggtaatcaattagaagtaatgatttcctaattcttcgcacaataatatactgcattcattaccgaccttgccttgtgtttggttctgagttacatgagtgttgaggctctctgagttctctttcagtatgtgcaaatgtcaactcccggtggggacaaaccattgttaattgttggtttcggtctcaactaggaatgccttgtactggtctttggttcaacaaaccaccaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggaattgtttgtctacattcacttgtattcaaatcctctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI