Specimen 879

Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 879
Collector Pamela Hallock
Identifier Pamela Hallock
Collected on July 1998
Habitat Sea grass meadow
Depth < 1m
Location USA, Florida Keys, off Keys Marine Laboratory
Latitude, Longitude 24.49, -80.48

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatattttatatataataaacataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataattatatttttagttctgccttaatggatttaaagtgaacaatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacaatatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaagtcgtgattattataatacatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Archaias angulatus | genomic DNA | 879 | taxon:46130 | USA: Florida Keys | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatataataatagttatatttggataactaagggaaagtttggctaatacgttttagatgtatttaataatacatatgcatataataatattgcaacatgatagatattatataatattataattacattattgtaattatataagagcagactttataatatattatataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgataatataacttaatatataataatatattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatatattttatattgttttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatatttaattatattatttgaattttcaagtggagggcaagtctggtgcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaatatcacagactgtattcaatactgtgaacaaaccagaatgtataaaatatgttaatattaatatcattagcaatgaatgttttatcatggaatattgcatatttatgtcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctattaagactaacaaaagcgaaagcacttaactagattattctctttgtattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcagactatgggatttcaattgaatatagtttacttcaactattaaataatatatgattgagtataattataatactctcatatttaattaatattttgaatattatttcaaattatatgtactttgcgctcatataattatataggtgagatgtaagcattatagatgatcaatatatatactttttagtatgtattattgtaattctaattaaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggtagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtttattatattttatatataataaacataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagtaaaataaaatatatttaatatataattatatttttagttctgccttaatggatttaaagtgaacaatattattattattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatacaatatatttattatataaattaaacctatttcgaaagtaaatgggtaatcatttaaaagtcgtgattattataatacatataattaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataaatctaagggacaataattaattaatataatttatgaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI