Specimen 9

Species Rotaliida > Nummulitidae > Nummulites > Nummulites venosus
Isolate number 9
Collector Johann Hohenegger
Collected on March 2004
Habitat soft sediment
Depth 19m
Description Agamont
Location Japan, Motobu, Okinawa

Barcode sequence

SSU partial

>Nummulites venosus | genomic DNA | 9 | sediment sample | taxon:159862 | single cell, Agamont | Japan:Motobu, Sesoko | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgcatatcactatttatgcgatatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgacccctcttaattgagcgcgtgtctttgattgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttacctttataccaaacacggtgcactaatattctaattattactcgcttcgtgcaaaaaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattggcagtgagcatctcatttttacacaccgcatgcgcgagtctatttattcaccattttgtgtgttttaaatatgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcctgccttgttgcaggtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatatctctatatgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI