Specimen 12959

Allogromia sp. 1_12959 Allogromia sp. 1_12959
Species "monothalamids" > Clade M > Allogromia > Allogromia sp. 1
Isolate number 12959
Collector Jackie Guiard
Identifier Jan Pawlowski
Collected on October 2010
Location Cyprus

Barcode sequence

SSU partial

>Allogromia sp. 12959 | genomic DNA | 12959 | taxon:944417 | 9 | Cyprus | Oct-2010 | Jackie Guiard | Jan Pawlowski | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccgaacacgctcttnattgacaggtttttataagactatatataattatttttaattatatatagcaattcttatatcaaatatgctagtcctttcatgattgcgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactttaatgagtatatattgaatactttgtttgcacataaagttgctgcattgttttttaactttgcacctttattgttgcacggtattcttttaaatatactctgaaggcaacgaacgtgaccgcaacattttgttgcataatcttatttatgctaactaaatggaccgctggatcttttctaaacagaggaagattgcggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgattattgcagtaagcatctatataggattatattaatccgcaggaattattaaatatataattttttatatatttatcctgtttaaccaactttgaaagtaagttggtaatcaattcgaagtaatgatttccttttgcacaataataatattttattctattaatcttaatctttatgattttgtattaaagttaaaatatgtgctcctttatttcatggtggggactgaccattgttaattgttggtcacgtctcaactaggaatgccttgtactggtcttggttcaacaaaccaccaggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactattctgtgagtatacaggacgggaactctattcatttnnaangattgagttctataagaatgtacgcgaacagtnnnnncnnnnnanaagagaagtcgaacaaggcaaagg

See sequence on NCBI