Specimen R1

Species Rotaliida > Rosalidae > Rosalina > Rosalina sp. 1
Isolate number R1
Collector Heike Bender
Identifier Heike Bender
Collected on June 1984
Location North Sea, Langeoog, Germany

Barcode sequence

SSU partial

>Rosalina sp. R1 | genomic DNA | R1 | taxon:944409 | North Sea | Sep-2010 | Christoph Hemleben | 18S rRNA | 18S rRNA | 18S ribosomal RNA tgctgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaggaactatatttcttatgtatgttgtcagcgcattgacccctcaactgctacaattcttaattgaattgacttttgctgcgcgtgtctttgattctcgtctggctcatacgattagttcctgaaagcaacgaacgtgaccgcaacctcttgttgccttcaaatcataatacatgcactcatttgatgaatttcatttgtgtgcatacggaggctttctaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttacttaatacatcgcaagcgcgagtccgtttgttctttgtttcagttcatgctgttcagagcttcaaatgagtatctctgcgcgcgataaagcctgctttgaaagtttagtgggtaatcaattagaagtaatgatttcctaaatttatcgcacttatatgtacggcgtctttacccagctggccttttgtgccagaattcgtgtgtatcgacgattgatttcttataatcaattgcctttcttacggtaccgtacgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacagaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctctt

See sequence on NCBI