Specimen R2

Species Rotaliida > Rosalidae > Rosalina > Rosalina sp. 1
Isolate number R2
Collector Heike Bender
Identifier Heike Bender
Collected on June 1984
Location North Sea, Langeoog, Germany

Barcode sequence

SSU partial

>Rosalina sp. R2 | genomic DNA | R2 | taxon:944408 | North Sea | Sep-2010 | Christoph Hemleben | 18S rRNA | 18S rRNA | 18S ribosomal RNA tgacaggcaatatcagcgcatctctgatgctgctgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaaggaactatatttcttatgtatgttgtcagcgcattgacccctcaactgctacaattcttaattgaattgacttttgctgcgcgtgtctttgattctcgtctggctcatacgattagttcctgaaagcaacgaacgtgaccgcaacctcttgttgccttcaaatcataatacatgcactcatttgatgaatttcatttgtgtgcatacggaggctttctaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttacttaatacatcgcaagcgcgagtccgtttgttctttgtttcagttcatgctgttcagagcttcaaatgagtatctctgcgcgcgataaagcctgctttgaaagtttagtgggtaatcaattagaagtaatgatttcctaaatttatcgcacttatatgtacggcgtctttacccagctggccttttgtgccagaattcgtgtgtatcgacgattgatttcttataatcaattgcctttcttacggtaccgtacgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacagaccacccggaa

See sequence on NCBI