Specimen U26

Uvigerina peregrina, Norway, Oslofjord
Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina peregrina
Isolate number U26
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2001
Habitat soft sediment
Depth 195m
Location Oslofjord, Norway
Latitude, Longitude 59.382, 10.373

Barcode sequence

SSU partial

>Uvigerina peregrina | genomic DNA | U26-1 | taxon:212521 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtttctcacgagtgagaaagcttacgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttgattgcactttgacccctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttactttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcacattgccttcacgggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttctttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttctccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcatcgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI