Specimen U67

Uvigerina peregrina_U67
Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina peregrina
Isolate number U67
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat soft sediment
Depth 87m
Location Oslofjord, Norway
Latitude, Longitude 59.382, 10.373

Barcode sequence

SSU partial

>Uvigerina peregrina | genomic DNA | U67 | taxon:212521 | small subunit ribosomal RNA aaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtctttcacgagtgagaaagcttacgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttgattgcactttgacccctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcacattgccttcacgggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcatcgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgc

See sequence on NCBI