Specimen U169

Uvigerina peregrina_169
Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina peregrina
Isolate number U169
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on May 2003
Habitat soft sediment
Depth 92m
Location Skagerrak
Latitude, Longitude 58.528, 11.0675

Barcode sequence

SSU partial

>Uvigerina peregrina | genomic DNA | U169-2 | taxon:212521 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtctctcacgagtgagaaagcttacgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttgattgcactttgacccctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcacattgccttcacgggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctctgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcatcgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI