Specimen U184

Uvigerina peregrina_U184
Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina peregrina
Isolate number U184
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on May 2003
Habitat soft sediment
Depth 60m
Location Skagerrak
Latitude, Longitude 58.5815, 11.0543

Barcode sequences

SSU partial

>Uvigerina peregrina | genomic DNA | U184-5 | taxon:212521 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtctctcacgagtgagaaagcttacgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgctgttgattgcactttgacccctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatcccattttttacacaccgcatgcgcgagtccatttattcacattgccttcacgggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacaggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcatcgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Uvigerina peregrina | genomic DNA | U184-2 | taxon:212521 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtctctcacgagtgagaaagcttacgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttgattgcactttgactcctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcgtctcattttttacacaccgcatgcgcgagtccatttattcacattgccttcacgggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcatcgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgcagaaggatca

See sequence on NCBI