Specimen U27

Species Rotaliida > Uvigerinidae > Uvigerina > Uvigerina peregrina
Isolate number U27
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat soft sediment
Depth 195m
Location Oslofjord, Norway
Latitude, Longitude 59.382, 10.373

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtctttcacgagtgagaaagcttacgtacattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttgattgcactttgacccctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatggattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcacattgccttcacggggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcattgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaac

See sequence on NCBI

Other sequence

SSU total

>Uvigerina peregrina | genomic DNA | U27 | taxon:212521 | small subunit ribosomal RNA ctcaagattaagccatgcaagtggttacattaacccgacagtttaaataagtgttcaatgctatcacgcatatatgcaatgcatgcaaaaatatatttacgcatacacacacacacacccgcgcatatatattaaggcaagcaacgcatgaattttgtttacgatagtaacaaaatttcagcgtgaatcacacatacgcacacagtgaatcaaagcgaaattttacaatttcaacgtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcacacacacacacacacacacacgatttctctgtatcgcatattcatacaagaagaaaattgcgttacaccgtgacactttttatcttttttatggataactcagggaaagtttggctaatacgtacgagtacaatacacacacacacacacacacacactctatacamtactcaacactcagtgrtaatctttgatttaygtgtattcttacgcgtctatcawtataaagtttaatcgcaacatgagagacattgagcacgcacgtgtartgtgaatttattcacgttacacacccacgctgagcagactktgcgaagtttacttttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcatactatatttgcaatttactttattacgcattacgacactgtactattttattctgttatacacacacacacacacatccttgttcacacgcgtaagtaagttattatatatatacgtatattttatttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaaccttttaacggtgttacgtaaaaatttcactgttgatgtatctgaattcaagtggagggcaagtctggtgcnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaatatgaattttttattcgctaataaattctatatttcagtattctcgcatatgtgtgatacacacacacacacacctacatacatatgcgttcgacgctgttatttcaaatatacgcgtcttgtatatttcttacggcaatttttttttctgcgacatgcacacacacacacacacacacacatttgtgcaccactcgcacacggggaaaatttttgtcactagtatttattcgcaatacacacacactcatatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcataccggttaaagatttacgtcttcgatcacacacacacatgttacgcatacacacatacacacgctttcgcgagcgcgcgtaatttacaaggtcgctaaatatttctttaacggttaaaaatgtcgatggagatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttgggctaggctatactctttgtgattatattatatacgtacacccacacacactcacacacacacatgtatattatttttttgcgcatacacacacacacacacttgcgcatcaacaattgttacatacacacgcgtatattttttaatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcatttattcacaataaattgcaaatttcctcagcctacaaaatttattcggcttgagctcgtgattctatcacgctcgcctatagtattttttcgtatggtctcgatggacgtttcatttatttatattttttgcgtgtaagcattatgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactatgttattctgcccgtaccgcgtatgtgttcactcacatttcgcctggtatccgtgtgcagtatttaacaatttcggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatatgtgtgacttttttgtctttcacgagtgagaaagcttacgtacattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctatacaattacgtatgttgttgattgcactttgacccctccttcacgggtgcgtgtgtctttgctttgcttcaactcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgctttcgtataccatttataacacagttttttttatatatgtattcgtacatcatataaaattgctgtgcaagaaagctttttaaactagagggaccgctgttatcttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatggattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcacattgccttcacggggctgtgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttctgcacacatatatacggcagctatacccgggtaaccttgttgttacttttgtgtgtatagttgtaccctttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgaaggactgggaacgcattgcgtttacgctttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcagtaggtgaac

See sequence on NCBI