Specimen 308

Species Rotaliida > Nummulitidae > Heterostegina > Heterostegina depressa
Isolate number 308
Collector Rudolf Röttger
Identifier Rudolf Röttger
Collected on October 1996
Habitat soft sediment
Location Hawaii

Barcode sequence

SSU partial


See sequence on NCBI

Other sequences

LSU partial

>Heterostegina depressa | genomic DNA | 308 | taxon:196924 | 6 | Australia:West Australia | 28S rRNA | 28S rRNA | 28S ribosomal RNA gcgcaataatagaaactacccaggattcccttagtaacggcgagtgaagtgggaagcagtgcatacgtcgcgtaatctattacgtgttcgtagctcagcccgtcgatataatccattcttagctgtcgtacttcggtacttctgctggaaggaattgtagcatcgaaagcattcaagttgtattcatcacacacacgcatagcaatacacacacacatacacacccctgctgctgcaacgtgttaatacacatagtgttatcatatatacgattcaaacacacagcgtttagcgctggaaagcaatccttgtagtttcactacagccatagagtgtgacagccacgttttatggaaatattgatacgctcgtaatacacacacacgcacgcagtctctctatgtatatgcacatgcagagtgatacataacgcattacgcgtctgaatacgtaattcgtgaatgttgaccctgagtcgagttgttt

See sequence on NCBI

SSU total

>Heterostegina depressa | genomic DNA | 308 | sediment sample | taxon:196924 | single cell | Australia:Western Australia, Agamont | 18S rRNA | 18S rRNA | 18S ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataagtgttaaaatgctacccatacacactcatacacgcattatacgaggttgcttacggtagtaacgatttcagcgtgaatcacaccctacagtgaatcactgcaatgaatttcattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctcatatattatgatattcgcgtatcatatatatatactgtacacacatacattgatttctctgtatcgcttgtcttataaggagatgcgttacaccgtgacaattttctttatggataactcagggaaagtttggctaatacgtacgagtaataacctcatcacacacatacacatacaccaatgtatatgtaagacacacactactcagcactcaatggtaaactttggcttcgttcgcgtcgccagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgtcgcgccttcgggtgcctcacatctacgctgagcagactttggcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaatcacatacacgattgatattattacgcgttaacaatttactgacaacacacatacactgtgtgcagcatatataacacattatatttattctgtcacccgacagaacacacacacatccttgttcacgtaaatatcctcgctatatgtaattaattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctccttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttgaccggtgtttgtaatatttcactgttcatgtatctgaatttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaacactatatgaatgaattctattcgttctgcgtttgatagttttacgtgttacgtattttatacgtttcgcgtatcgacgctacctaacatgaaattattaccacgtatacggtttaccgtgttacagtgatatttcttattatactagcacactcgctctgctgtatcgtaacacacacacacacccacactgcagtaactgagtgatcagtatataccatttacgtcatggtatgatacacgcagagaattgaatacattctcttatttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttcagcctgtaagaattattacgtacatacgctgcgcataatattcacacacatacacacccgctgcagcagtggtaagcttattatacgctatgtaaaaaattcataacggttataaatgtcgatggggatagttggaagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagattccaaaagcgaagcagttggctaggttatactcttgggcttgcgccagggaattatcattataggcccatgcagtccacacacatacacacacttctgcagtagtggccatatatatttccattaccacacagcgcattacactttacaatgaagaacgaaggtttggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttcttttaaattgcaaatctcctcagcctacaaaatgacttggcttgagctcgtaactctgttacgctcgcctgactattttcgtacggtctcgatggacgtttcatttaattatctttgcgtgtaagcattgtactaatctttgaaacacaagattgtactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcagtatgttatattacccgcagtgtatgtctttggacatttcatctgtcgtgttgtaattaacaccatttactgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagatcttcatctctgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggtattattgtattgatcacacctcagtgtgtgtatctatacatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgatgcggcgctttgacccctcttaattgagcgcgtgtctttgtttgcttagctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctctataccaaacacatggttgtatctttatgattacgctttgtgcaaagaggccttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattatttgcagtgagcatctcattcttacacaccgcatgccgcgagtctatttattcacctttagtgtgctttaaaatatgtatctcttgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttatatagcacacatatatacggcatctttacccggcttaccttgttgtaagtttcttgtgtgtattgatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataattcattatatgcacacctatggaaacttaaacgaacagtgtggtctaaagggaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI