Specimen C24

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number C24
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat soft sediment
Depth 54m
Location Oslofjord, Norway
Latitude, Longitude 59.391, 10.373

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactggagggattgacaggcaatattaatacgttttgcttcggtaatcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaattttcgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtggatgcccttagatgttccgggctgcacacgtgctacaatgattactgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Cibicides lobatulus | genomic DNA | C24 | taxon:325267 | small subunit ribosomal RNA gtttaaataagtgttaaatgctaccattaaacttatcgtatatcacgcatagaccgattttgtttacggcagtaacaatttcagcgtgttatcacccatcacagtgaatcactgaaatttaccctacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgcaataaaaattttcattgaaacaccctctcttttttgcgggggcagatcggtgatcatttttgttttgttgcattcacgcatacaaaatttttttgatttctctgtatcgcttattctttaaggacattgcgttacaccgtgacaattttttctttatggataactcagggaaagtttggctaatacgtacgagtatatttttactacacatacgcacacacattcaaattaatttttgtatcgctgtgtatcaactactactcagcactcatggtaaactttggccacgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaattcaaattgtatttacatgcgttacacaatttacaacattatacaagtttttaatgacagtacattataacactttcattttttctgttatcattacacatatatccttgttcgttgtactttcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgtttatgtatctgaatttcnnnnnnnnnnnnnnnnnnnnnnnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaatacgaatgaatttctcattctgtttgaagttttacgcattaatatatatacatatttctatctcgcatagatttatttatttttttttgcgttcgacgctgttaaaatttatacaatttcaccgttgtattaaattttagtttttacacggcgcaaatttttactgcacacgcattatatagattttttctacgcacacacgctttatattttgccaacgcgggaaatctttgtatttttcgaacactcgcttaraatttattcgccttttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttctgacgttaaaaatttttactgcactttttacaagcgctgtactttttttttccacacacgtttatctgtcatgctgcggcccgtttagggaagttatactagcatgcagggagagacgcacatgttacatgccacgtaaatattattatctcatactatccacggtaaattatttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagcggtgaaatgcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattattatatcttacgcacgctgcgtgacaatttttcctcactttgcttttatacggcattacacactgtacactgcgtatactgcgcattttggaatttttttcacacacagcgctgcgttatcatatatatatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatggactctcaattgcattttttattaaattgcaaatttcctcagcctacaaaatgacttggcttgagctcgtattttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttatattttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcatactacccgcagcatataccttcgggtattttgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacactctcctctgggggaagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactggagggattgacaggcaatattaatacgttttgcttcggtaatcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaattttcgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtggatgcccttagatgttccgggctgcacacgtgctacaatgattactgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI