Specimen C120

Cibicidoides lobatulus_C120
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number C120
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on May 2003
Depth 32m
Location Skagerrak
Latitude, Longitude 58.208, 11.241

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggtaaacgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgccttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaatttttacgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggtaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Cibicides lobatulus | genomic DNA | C120 | taxon:325267 | small subunit ribosomal RNA ctcaaagattaagccgcaagtggttatattaacccgacagtttaaataagtgttaaatgctaccattaaacttatcgatatatcacgatagaccgattttgtttacgacggcagtaacaatttcagcgtgttatcacccatcacagtgaatcactgaaatttaccctacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgcaataaaaattttcattgaaacaccctctcttcattgcgggggcagatcggtgatcatttttgttttgttgcattcacgcatacaaaatttttttgatttctctgtatcgcttattctttaaggacattgcgttacaccgtgacaattttttctttatggataactcagggaaagtttggctaatacgtacgagtatattttatttttactacacatacgcacatacattcagattaatttttgtatcgctgtgtatcaactactactcagcactcaatggtaaactttggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgcgtcttcggacgcttcacgtcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaattcaaattgtatttacatgcgttacacaatttacaacattattacaagtttttaatgacagtacattataacactttcattttttctgttatcattacacatatatccttgttcgttgtactttcagcatatatagtattaatttattattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgtttatgtatctgaatttcaagtggagggcaagtctggtgcnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaatacgaatgaacttctcattctgtttgaagttttacgcattaatatatatttctatctcgcatagatttattttttttttgcgttcgacgctgttaaaatttatacaatttcaccgttgtattaaattttagtttttacacggcacaaatttttactgtcgcacacgcattatatatatacatcatttctacgcacacacacacacacgatttatatattttgcaaacgcgcgggaaatctttgtattttttcgaacactcgcttagttatttattcgccttttcaacactgtgaacaaatcaragtgtattaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttctgacgttaaagatttttactgcactttttacaagcgctgtacttgattttttccacacacgtttatctgtcatgctgcggcccgtttagggaagtatactagcatgcagggagagacgcacatgttacatgccacgtaaatattattatctcatactacccacacacggtaaattatttttaacggttaaaaaatgtcgatggggatagttggagtcaacagtattgctgggcgagcggtgaaatgcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatatatcttacgggacgctgctgtgctgcctgcgtgacacattttttttttctcagcattgctttatacggcattacacactgtacactgcgtatactgccatctttgcgaatttttttgtctcacacacagacacacacacacacagcgctgcgttatgcatatatatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatggactctcaattgcattttttattaaattgcaaatttcctcagcctacaaaatgacttggcttgagctcgtattttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttatatttttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcatactacccgcagcatataccttcgggtattttgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacactctcctctgggggaagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggtaaacgcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgccttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaatttttacgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggtaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI