Specimen C170

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number C170
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on September 2003
Depth <10m
Location Mediterranean Sea, Marseille, France
Latitude, Longitude 43.18, 5.22

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggcaatcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttctttaattagagagcgcgcgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcctgttgcctttataccaaacatgttttgcgtcaattttcgaattgcgcgcatttgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggggacgcagaaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtgtaacaaggca

See sequence on NCBI

Other sequence

SSU total

>Cibicides lobatulus | genomic DNA | C170 | taxon:325267 | small subunit ribosomal RNA ctcaaagattaagccatgcaagtggttatattaacccgacagtttaaataggtgttaaatgctaccattaaacttatcgtatatcacgcatagaccgattttgtttacggcagtaacaatttcagcgtgttatcacccatcacagtgaatcactgaaatttaccctacattcagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggcgcaataaaaattttcattgagacaccctctctctctctctctcttttgcgggactgactgggcagatcggtgatcatttttgttttgttgcattcacgcatacaaaatttttttgatttctctgtatcgcttattctttaaggatcattgcgttacaccgtgacaatttttttctttatggataactcagggaaagtttggctaatacgtacgagtatatatttttttatttacccacatacgcacacacactcaaattaatttttgtatcgctgtgtatcaactactactcagcactcaatggtaaactttggctgcgcttgcgcggtcagtttaaagtttaactgcaacatgagagacattgagcacgcacgtgttgtgtcttcggacgcttcacatcacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgcgagtaccctacaattcaaattgtatttacatgcgttatcaacaatttacaacattacatacaagtttttaatgacagcacattataacactttcattttattctgttatcattatacacatatatccttgttcacgttgtactttcagcatattataatattaatttattattatttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcggtgagtttaagcaactcagaacctttggacggtgttagtaaaatttcactgttnnatgtatctgaatttcaagttgagggcaagtctggtgcnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactgcaaatacgaatgaatttctcattctgtttgaagttttacgcattaattatatacgtatatatttctgcgcgtctcgcacgcatagatttattattattattttttctgcgttcgacgctgttaaaatttatacaatttcaccgttgtattaaattttagtttttacacggcgcaaatttttactgcacacgcattatatattatttttctacgcacacaccctttatgtattttgccaacgcgggaaatatttgtgattcgaacactcgcttagaatttattcgccttttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgcactttctgacgttaaaaatttttacgtgcctctgttttacaagcgctgtacattattttttacacacacgtttatctgtcatgctgcggcccgtttagggaagttatactagcatgcagggagagacgcacatgttacatgccacgtaaatattattatctcaatactcttttacggtaaattatttttaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagcggtgaaatgcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattatatatattttacgcacgctacgctgcagtgataattttttcgccattgctttatacggtattacacacactgtacactgcgtatactgccattttgaaatttttactcacacacacacagcacacgcgctgcgttatcatatacatatatacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatggactctcaattgcattttttattaaattgcaaatttcctcagcctacaaaatgacttggcttgagctcgtattttttatacgctcgcctaacttttttcgtacggtctcgatggacgtttcatttatattttttgcgtgtaagcatttgttattctttgaaacataagaatgcattgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcactgtgtcatactacccgcagcatataccctcgggtattttgtctgtcgtgtgtagttgacaatcttggtgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacactctcctctgggggaagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggcaatcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttctttaattagagagcgcgcgtcttagtttccgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcctgttgcctttataccaaacatgttttgcgtcaattttcgaattgcgcgcatttgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactggggacgcagaaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtgtaacaaggca

See sequence on NCBI