Specimen C2

Cibicidoides lobatulus_C2
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number C2
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on September 2001
Habitat sand bottom
Depth intertidal
Location Iceland, Sandgerdi
Latitude, Longitude 64.02, -22.42

Barcode sequences

SSU partial

>Cibicides lobatulus | genomic DNA | C2.2 | T. Cedhagen C2 (UniGE) | taxon:325267 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgrgaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggtaatcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattaaagagcgcgtgtcttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaattttcgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagttgtaacaaggca

See sequence on NCBI

SSU partial

>Cibicides lobatulus | genomic DNA | C2.9 | T. Cedhagen C2 (UniGE) | taxon:325267 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagtatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggtaatcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttaattttcgctttgctcatacaattaagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaattttcraattgcgcgcatttcatgaaaaaaggctttttaaactaaarggaccgctgttactttcttaaaccaaaagaaggttgcrgcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcaatgagcatctcatttttacacacccgcatgcgcgagtccatttattcaccttcgggtgtwttaaatgtgtatctctgcgcgcggtaaagctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgcctcgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI