Specimen F77

Cibicidoides lobatulus_F77
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides lobatulus
Isolate number F77
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on October 2006
Habitat Epizoic/Tunicate
Depth 148m
Location Norway, Bergen
Latitude, Longitude 60.18, 5.12

Barcode sequence

SSU partial

>Cibicides lobatulus | genomic DNA | F77 | taxon:325267 | small subunit ribosomal RNA | s14-sB tggcttaatttgactcaacgcgggaatcttaccgggtccggacacactgaggattgacaggcaatattaatacgttttgcttcggtaacatcgtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtgtgttgcatcgcactttgacccctttctttaattagagagcgcgtgtcttagttttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgttttgcgtcaattttcgaattgcgcgcatttcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtatctctgcgcgcggtaaagcctgcttcgacagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttattctgcacacctatggaaacttaaacgaa

See sequence on NCBI