Specimen C171

Species Rotaliida > Incertae sedis > Cibicides > Cibicides refulgens
Isolate number C171
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on November 2001
Depth <10m
Location Mediterranean Sea, Marseille, France
Latitude, Longitude 43.18, 5.22

Barcode sequences

SSU partial

>Cibicides refulgens | genomic DNA | C171.2 | D. Longet C171 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacaccctctctcgtagatgtgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgagagtaagtgggtaatcaattagaagtaatgatttccttttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacggaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Cibicides refulgens | genomic DNA | C171.4 | D. Longet C171 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctctctcgtagatgtgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacacggcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Cibicides refulgens | genomic DNA | C171.6 | D. Longet C171 (UniGE) | taxon:212459 | small subunit ribosomal RNA attgacaggcaatattaatattacactctctctcgtagatgtgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggaactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttattaaaccaagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgaagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttatgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatataccgcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacct

See sequence on NCBI