Specimen C172

Species Rotaliida > Incertae sedis > Cibicides > Cibicides refulgens
Isolate number C172
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on September 2003
Depth <10m
Location Mediterranean Sea, Marseille, France
Latitude, Longitude 43.18, 5.22

Barcode sequences

SSU partial

>Cibicides refulgens | genomic DNA | C172.1 | D. Longet C172 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctcttcgtagatgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtgtttgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagcgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttttgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggtgaacctgcagaaggatca

See sequence on NCBI

SSU partial

>Cibicides refulgens | genomic DNA | C172.6 | D. Longet C172 (UniGE) | taxon:212459 | small subunit ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatattacactctcttcgtagatgtgtatattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcggcactttgaccccttttctcgttaaaagcgcgcgtcttagtttgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttattaccaaacattgtttatgcgttctgcgcatatcgatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggccgcacacgtgctacaatgattattgcagtgagcatctcattttttacacaccgcatgcgcgagtccatttattcattatccttcgggttttgctttaaatgtgtatctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttttagcacacatatatacggcgtttatacccgggtaatgcttgtcgttacttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgcatcttaccgatggacttctctgtgagtttgagggactgggaacgcatataatttcgattacttgcacgcctatggaaacttaaac

See sequence on NCBI