Specimen C29

Cibicidoides ungerianus_C29
Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides ungerianus
Isolate number C29
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on April 2002
Habitat soft sediment
Depth 195m
Location Oslofjord, Norway
Latitude, Longitude 59.391, 10.37

Barcode sequence

SSU partial

>Cibicides ungerianus | genomic DNA | C29 | M. Schweizer C29 (UniGE) | taxon:349559 | small subunit ribosomal RNA aacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacttttttgcttcggcattgagtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacatgtttgtataatttttattacgcattcatgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggcgttttaaatgtgtacctctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcctttttttagcacacatatatacggcgtctatgcccgggttaccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacacctatggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatcggtaggt

See sequence on NCBI