Specimen F8

Species Rotaliida > Incertae sedis > Cibicidoides > Cibicidoides ungerianus
Isolate number F8
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on October 2006
Habitat Epizoic/Tunicate
Depth 148m
Location Norway, Bergen
Latitude, Longitude 60.18, 5.12

Barcode sequence

SSU partial

>Cibicidoides ungerianus | genomic DNA | F8 | taxon:673210 | small subunit ribosomal RNA | s14-sB atgtggcttattttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatattaatacttttgcttcggcacttggtattatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcctataaatttacgtatgttgcatcgcactttgacccctttcttaattgaaagcgcgtgtcttagtttcgctttgctcatacaattaggtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacgtgtttgtataatttttattacgcattcacgaaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatttttacacaccgcatgcgcgagtccatttattcaccttcgggtgttttaaatgtgtacttctgcgcgcggtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttccttttttttagcacacatatatacggcgtctatgcccgggctgccttgttgtagcttttgtgcgtatagatgttttttccgtatgtgcgattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggaacgcaggaatttatttctgcacaccttatggaaaactaaaacg

See sequence on NCBI