Specimen 641

Ammonia sp. T1_641, spiral view Ammonia sp. T1_641, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T1
Isolate number 641
Collector Juan Montoya
Identifier Maria Holzmann
Collected on January 2001
Habitat salt marsh
Location Cuba, Playa Bailen

Barcode sequences

SSU partial

>Ammonia sp. 641 | genomic DNA | 641 | taxon:155840 | 2 | true | Cuba:Playa Bailen | Feb-2001 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgtcgtgcgttgagctctctcgggggccgagcgcatgactgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcataaaaagagacctagtatacgcgtaagatatcgtttacggttcgtgacccccttcgggcgtgtgtcgcacgtacgtatcatacgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgaatgtatgcatcttcgggtgtatctaccgctgcttagtgcgtatgcgtacttcggtgcgtgtcgtacattaaactatagagaccgctgtattttttttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtggacgccacggtatgtatttatgcttcggcgtagtatatatcagttggtcggccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactnccatagaccatggtacacacttatatatgtacgcgcaggttctacccggccngcctttgtgtcggtgcagtgcgtancgngntntttcgtacgtancactctgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtctcacctaggaatncctggtacgggtctccggttcaacataccacccngaaaagatcccncccctttgaacncnccgcccgncnctctaganaanngannacactangaatntatagcactcccaaaggtgtnnggncccggtaagntagngganatagatacgaatagtgtgannnnnnnnaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 641 | genomic DNA | 641 | taxon:155840 | 1 | true | Cuba:Playa Bailen | Feb-2001 | Maria Holzmann | Maria Holzmann | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggcgcatgtggcttaatttgactcaacgcgggaaatcttaccgggcccggacacactgaggattgacagatatacgtcgtgcgttgagctctctcgggggccgagcgcatgactgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcataaaaagagacctagtatacgcgtaagatatcgtttacggttcgtgacccccttcgggcgtgtgtcgcacgtacgtatcatacgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgaatgtatgcatcttcgggtgtatctaccgctgcttagtgcgtatgcgtacttcggtgcgtgtcgtacattaaactatagagaccgctgtattttttttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgtggacgccacggtgatacgtttcggcgtatcattagttggtcgaccacgccgaacctacttcgaaagtaaaatttttaagtgggtaatccattagaagtaatgactcgcatagaccatggtacactctttatgtacgcgcaggttctacccggccggcctttgtgtcggtgcagtgcgtagcttgttgtttcgtacgtaccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtccctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaaattgttgtacctcggtaccgcgcttagtggaaatatatnnnnntagtgtgatctaaaggaaagagaagtcgaaca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 641 | genomic DNA | 641 | taxon:155840 | 1 | single cell | true | Cuba:Playa Bailen | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggatacccaatatataccatctgtgcgtacctcggtgcgtacaaattttagcccgtcgatactatcctagcatagtactggcttcggccggtaacctatctatgcgggaattgtagcatcgtacaaaaatatattatacaacgtatatacgcaacccacacttatatatatttttatgcgtacacttactttcataaacacacagcgctcccgcgttggaaagcaagtctatatcctttttggatatgccatagagtgtgacggccacgtttcaactctctacgtatacgcatgcgttatatacatacactgtattttatatataacctgagtnaagttattt

See sequence on NCBI