Specimen 559

Ammonia sp. T3_559, umbilical view Ammonia sp. T3_559, spiral view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia batava T3
Isolate number 559
Collector Tomas Cedhagen
Identifier Maria Holzmann
Collected on September 1997
Habitat soft sediment
Location Sweden, Tjärnö

Barcode sequences

SSU partial

>Ammonia sp. 559 | genomic DNA | 559 | marine sediment | taxon:998792 | 4 | Sweden:Tjaerno, Koesterfjorden | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctgcgttgctctcgagcacgtggctcaaagatgctagttctttcatgattatgtgataggtggtgcatggcgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtgtacgcgtattactcatgtggtagtgacccccttctcacggaggcgcgtgtcgcacatatggtatacgcaccggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaattatacgtgtgctttatgcatacattcccactgcttagtgtgcgtatcagtacttgtactgtgcgtcacacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcactgcactgtgcatctaacccaatgtgcgcggacgccacgatgtgtaattgccttcgggcattttatatattcgcttgtgcgactgcgccgaacctacttcgaaagtaaaatttttaagtgggtaatccattagaagtaatgactcgcatagaccatggcacactatatgtacgcgcaggtctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccactccgtattaattcgtacgtgggggtagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctttgcggcgtgttcgcacaccgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 559 | genomic DNA | 559 | marine sediment | taxon:998792 | 5 | Sweden:Tjaerno, Koesterfjorden | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctgcgttgctctcgagcncgtggctcaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgnggagngatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtattactcatgtggtagtgacccccttctcacggaggcgcgtgtcgcacatatggtatacgcactggtctcagatagcaacgaacgtgaccgtattctattgttgcagtgaattatacgtgtgctttatgcatacattcccactgcttagtgtgcgtatcagtacttgtactgtgcgtcacacattaaactatagagaccgctgtttcttctttaaaccaaaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgccacgatatgtatttgccttcgggcattttatatattcgcttgtgcgactgcgccgaacctacttcgaaagtaaaatttttaagtgggtaatccattagaagtaatgactcgcatagaccatggcacactatatgtacgcgcaggtctacccggctcgccttcgtgtgagtgcagtgcgtagcttgctgtttcgtacgtgccactccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctttgcgcgtgttcgcacaccgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. AS2 | genomic DNA | AS2 | taxon:155587 | 43 | true | Sweden:Tjaerno, Koesterfjorden | 28S rRNA | 28S rRNA | 28S ribosomal RNA gagtcgagttatttgggactatagctctaatagtttggttggtggtaatgacacatcaaaggctaaatattggttagtcgatgcatattgcggagaccgatagcatacaagtaccgtaagggaacgatgaaaagcaccctattgagttcacggcgcagacttgcttcggttcgccgttgcttgtcccgcgcccaacaactacagtgggagtgaaagagagagtgaaatcgcctatacataaacaaatatactatatgcacacacacacacagtgtaattgcatacagcatacacacagtctgcgttagtacaatcggacagagtgtcgtataactttatatggccgcctaatatacgcacacacacaatgtattttatggtctggctcatagccggtttcgaccgctatacgcgacacaactgtacgacccgttttgaaacacggaccaaggagttcaactggattacgagtcgtagagtaacatgtatctatatacaactatatttacactcacacggcatagcgaaagcaacttaatcctttactgtgctaggtcggccctcaaaagctgaccgcagcacgcgctgagtgtgtatatacgtgagggccttagtgtcaacgcgtatacctgtcacagcttcggctgctaacaggatcactcaagcgttcaacgagtatatcttgttgagacccgaaagatggtgaactatgctcggatatggcgaagtcaggtgaaaacttgatggaagcttgcgttgtgcggaactgacgtgcaaatcgttaccgcctaacctgagtataggggcgaaagactcaacgaaccatctagtagctggttccctccgaagtttccctcaggatagc

See sequence on NCBI