Specimen 560

Ammonia sp. T3_560, spiral view Ammonia sp. T3_560, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia batava T3
Isolate number 560
Collector Tomas Cedhagen
Identifier Maria Holzmann
Collected on September 1997
Habitat soft sediment
Location Sweden, Tjärnö

Barcode sequences

SSU partial
SSU partial

Other sequences

LSU partial

>Ammonia batavus | genomic DNA | AS 3 (Tjarno Fjord, Sweden) | taxon:75326 | 3 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA | includes divergent domain D1 and flanking regions of conserved domains C1 and C2 (Hassouna et al., 1984) cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatataaaatatgcactctgtgcataatttagcccgtcgatactatcctagcatatcaccggtctcggccggtaaccaaatatgcgggaattgtagcatcgtaacaacacaaatatatacgcacacacacacacacatatgcctcacgcctcatagcacgtactgacatatcttgtaaacacacagcgtctccgcgttggaaagcaagtatatatcctctttggatatgccatagagtgtgacagccacgtttgaatcactcatatatgcagtacacgcaactcacacacatacacggcgcggcgtgtcgtgcacacacaatatatatttatataacctgagtcgagttattt

See sequence on NCBI

LSU partial

>Ammonia batavus | genomic DNA | AS 3 (Tjarno Fjord, Sweden) | taxon:75326 | 2 | LSU rRNA | LSU rRNA | large subunit ribosomal RNA | includes divergent domain D1 and flanking regions of conserved domains C1 and C2 (Hassouna et al., 1984) cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatataaaatacgcactctgtgcataatttagcccgtcgatactatcctagcatatcaccggtctcggccggtaaccaaatatgcgggaattgtagcatcgtaacaacacaaatatatacgcacacacacacacacatatgcctcacgcctcatagcacgtactgacatatcttgtaaacacacagcgtctccgcgttggaaagcaagtatatatcctctttggatatgccatagagtgtgacagccacgtttgaatcactcatatatgcagtacacgcaactcacacacatacacggcgcggcgtgtcgtgcacacacaatatatatttatataacctgagtcgagttattt

See sequence on NCBI