Specimen 391

Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T4
Isolate number 391
Collector Hiroshi Kitazato
Identifier Maria Holzmann
Collected on May 1995
Habitat Brackish lake
Location Japan, Hamana Lake

Barcode sequences

SSU partial

>Ammonia sp. 391 | genomic DNA | 391 | marine sediment | taxon:998788 | 9 | Japan:Hamana Lake | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgccgaatgatgcacttcggtgtatcttcggcttaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtagactcgcgtggtagtgaccccctcttgcaggcgcgtgtcgcacatgcgttatacgcactggtctccgatagcaacgaacgtgaccgtattctattgttgcagtgaaatgttaccacttcgttggtacgacccactgcttagtacgcgcgtgcctcgtgtacgcgtcgtcattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagaagttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccgatgtgcgcggacgccgcgtggcatgtataccttcgggttatatgtctgcgatcgtgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggccacactatatgtacgcgcaggtctacccggctcgcctttgtgtgaggggcagtgcgtagcctgttgtttcgtacgtgcactccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtaccggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagccgctcgctcgcgagcggcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 391 | genomic DNA | 391 | marine sediment | taxon:998788 | 10 | Japan:Hamana Lake | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcacacaagaacgcgtggagcatgtggcttaattcgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgccaaatatatcacgttcgcgtgtatttttggctcaaagatgctagttctttcatgattatgtgataggtggtgcacggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtagactcgcgtggtagtgaccccctcttgcaggcgcgtgtcgcacatgcgttatacgcactggtctccgatagcaacgaacgtgaccgtattctattgttgcagtgaaatgttaccctcgtggtacgacccactgcttagtacgcgcgtgcctcgtgtacgcgtcgtacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgccgcgtggcatgttgccttcgggtatatatgtctgcgatcgtgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacactatatgtacgcgcaggtctacccggctcgcctttgtgtgaggggcagtgcgtagcctgttgtttcgtacgtgcactccgtattaattcgtacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacnggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagcccctcgctcgcgagcggcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. AmmJ1 | genomic DNA | AmmJ1 | taxon:155598 | 4 | true | Japan:Hamana Lake | 28S rRNA | 28S rRNA | 28S ribosomal RNA gagtcgagttatttgggactatagctctaatagtttggttggtggtaatgacacatcaaaggctaaatattggttagatcgatgcatattgcggagaccgatagcatacaagtaccgtaagggaacgatgaaaagcaccctattgagttcacggcacagactcgacgcgcggttcgccgcgtgacctgtccagtgcccaacaactatagtgggagtgaaagagagagtgaaatcgcctatacataaaatatatgcactacacacagtaactgcatgcagtctgcgttagtacaatcggacagagtgtcgtatcattgtatggccgcctaatacataacacacacacattacactgtgtattatggtcaggcccatagctgggttcgcccgctatacgcgacacaactgtacgacccgttttgaaacacggaccaaggagttcaactggattacgagtcgtcgagtaacatctaatatgtacactcacacggcacagcgaaagcaacttaatcctttttacagtgctaggtcggccgtcaaaagctgaccgcagcacgcgctgagtgagtatatgcgtgagggcctcgtgtcaacgcgcgtacctgtacgcctttgtgcgaacaggatcactcaagcgttcaacgagtatatcttgttgagacccgaaagatggtgaactatgctcggatatggcgaagtcaggtgaaaacttgatggaagcttgcgttgtgcggaactgacgtgcaaatcgttaccgcctaacctgagtataggggcgaaagactcatcgaaccatctagtagctggttccctccgaagtttctctcaggatagc

See sequence on NCBI