Specimen 108

Ammonia sp. T5_108, spiral view Ammonia sp. T5_108, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia aoteana T5
Isolate number 108
Collector Bruce Hayward
Identifier Maria Holzmann
Collected on March 2000
Habitat salt marsh
Location New Zealand, Pollen Island

Barcode sequences

SSU partial

>Ammonia sp. 108 | genomic DNA | 108 | marine sediment | taxon:155798 | 13 | true | New Zealand:Pollen Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagnnnnggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgcgcatatactctctcgtggagtatatacgttcaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagctcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtagactcgtatggtagtgaccccctcttaattgaggcgcgtgtcgcacatacgttatacgcactggtctcagatagcaacgaacgtgaccgtactctattgttgcagtgaaaatgttgcttcggcaacaaacccactgcttagtacgcgtgtatttcggtacgcgccgtacattaaactatagagacccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcaccgtgcatctaacccaatgtgcgcggacgccgcgtatacgtgttttcctttcgggactcatgtatattgctgagcgaccgcgccgaacctacttcgaaagtaaaatttctctgtgggtaatccattagaagtaatgactcgcatagaccatggcacactataaaagtacgcgcaggttctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccacctcgtattaattcgtacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctctcacgctctcgcgcggaagcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 108 | genomic DNA | 108 | marine sediment | taxon:155798 | 3 | true | New Zealand:Pollen Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcngtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgcgcatatactctctcgtggagtatatacgttcaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagctcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctagtatacgcgtagactcgtatggtagtgaccccctcttaattgaggcgcgtgtcgcacatacgttatacgcactggtctcagatagcaacgaacgtgaccgtactctattgttgcagtgaaaatgttgccctcgcgctaacaaaccccactgcttagtacgcgtgtatttcggtacgcgccgtacattaaactatagagacccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcaccgtgcatctaacccaatgtgcgcggacgccgcgtatacgtgttttcttcgggactcatgtatattgctgagcgaccgcgccgaacctacttcgaaagtaaaatttctctgtgggtaatccattagaagtaatgactcgcatagaccatggcacactataaaagtacgcgcaggttctacccggctcgcctttgtgtgagtgcagtgcgtagcttgttgtttcgtacgtgccacctcgtattaattcgtacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctctggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagctattcgctctcgggcggaagcttagtggaaatatatatggatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 108 | genomic DNA | 108 | taxon:155798 | 7 | single cell | true | New Zealand:Pollen Island | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaacaaaatacatgtgcctcgcgcgcatgatttagcccgtcgatactatcctagcatattaccggtctcggccggtaactcaatatgcgggaattgtagcatcgtaataataaaaaaaatatatatgtgcacgcacacacacacacacccaccgcgtacgtacttgtaaacacacagcgtctccgcgttggaaagcaagtttatatcctctttggatatgccatagagtgtgacagccacgtttcactcataaccgtacgcacacacacacgccccgtgcactaatatatatttctataacctgagtcgagttattt

See sequence on NCBI