Specimen 464

Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T7
Isolate number 464
Collector Susan Goldstein
Identifier Maria Holzmann
Collected on December 1995
Habitat salt marsh
Location USA, Georgia, Sapelo Island

Barcode sequences

SSU partial

>Ammonia sp. 464 | genomic DNA | 464 | marine sediment | taxon:998790 | 16 | USA:Georgia, Sapelo Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcatagttcgctgtnncntagntganagatgctagttctttcatgattatgtgataggtggtgcatggcgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatatctgttgtggtagtgaccccctctccgaggcgcgtgtcgcacacacagtatatgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatcttgtatgcgtcactaccactgcttagcatatatgtgcactccgtgtacgttatgcactaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcgtatataccttcgggtgtatgtgtatcttgagagcgaccgcgccgaacctgcttcgaaagtaaaatttctaacgcgggtaatccattagaagtaatgactcgcttttagaccttggcacaatatatgtgcgcgcgggctaaccgttctggtcccttgtaccagttcagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcgacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggcaaag

See sequence on NCBI

SSU partial

>Ammonia sp. 464 | genomic DNA | 464 | marine sediment | taxon:998790 | 17 | USA:Georgia, Sapelo Island | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatacgctatgtgcgtctcgctgcgcatagctgaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaaaaatagagacctagtatacgcgtatatctgttgtggtagtgaccccctcctcgcgaggcgcgtgtcgcacacacagtatatgcactggtctccgatagcaacgaacgtgaccgtactctattgttgcagcgacagtgcgtatcttgtatgcgtcactaccactgcttagcatatatgtgcactccgtgtacgttatgcactaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcctcagtgcgtatataccttcgggtgtatgtgtatcttgagggcgaccgcgccgaacctgcttcgaaagtaaaatttctaacgcgggtaatccattagaagtaatgactcgctttagaccttggcacaatatatgtgcgcgcgggctaaccgttgtaacctctgtgttacttcagtgcttagctcgttgtttcgtacgtgccactccgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctgtaggactgccaaagcatatactcttcggggtatgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI