Specimen 647-Amm

Ammonia sp. T11_647, spiral view Ammonia sp. T11_647, umbilical view
Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T11
Isolate number 647-Amm
Collector Juan Montoya
Identifier Maria Holzmann
Collected on January 2001
Habitat salt marsh
Location Cuba, Playa Bailen

Barcode sequence

SSU partial

>Ammonia sp. 647 | genomic DNA | 647 | marine sediment | taxon:155846 | 6 | true | Cuba:Playa Bailen | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagatatatgcgcgacctcgcttcggcgcgagtcacgctggaagacgctagatctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatccaaaaagagaccaagtatacgcgtagaaccacgtggtagtgaccccctctttaaccggaggcgtgtgtcgcacacgtattatacgcactggtctcggatagcaacgaacgtgaccgtactctattgttgcagtgaaacagtgcttgccttcgggctcgcacgacccactgcttagtatatatgcgcttcggcgcataatatacattaaactatagagaccgctgttttttccttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcaaatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaaagtgcgtggacaacaacacctgcgcggcttcggccgtgcgtgtgtatgattgaccacgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacaaaataaagtacgcgcaggtctacccggctccgcctttgtgcagagtgcagtgtgtagcttgttgttttcgtacgtgccacctcgtattaattcgtacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaagcgcttgcgcttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 647 | genomic DNA | 647 | taxon:155846 | 13 | single cell | true | Cuba:Playa Bailen | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataatagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaataaaatatatatgccactcgttggcgtataatttagcccgtcgatactatcctagcatatttacctacggcttcggctgttcgtaaaataatatgcgggaattgtagcatcgtaataaaaaaatatacgtacaacacgcacaccgcaacgccataagcgtatataaaaagaaccttacttgtaaacacacagcgtacccgcgttgggaagcaagtatatatccttttggatatgccatagagtgtgacagccacgtttcaccctataataaaaggtcatacgcataacacaccgatacacccaaatggcaatgcatcgtgcataccgtacgaaaaatatattttttatataacctgagtcgagttattt

See sequence on NCBI