Specimen 1404

Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T8
Isolate number 1404
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on June 1999
Habitat soft sediment
Location Gulf of Eilat, Taba, Israel

Barcode sequences

SSU partial

>Ammonia sp. 1404 | genomic DNA | 1404 | marine sediment | taxon:998787 | 7 | Israel:Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgggagcatgtggcttaatttgactcaacacgggaaatcttaccgggtccggacacactgaggattgacagatatacgttgcgtgagctctctttgggggccgacgcaactgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctactatacgcgtagaaccgtatggtttgtgaccccctccctcgcggaggggtgtgtcgcacatacgttatacgcatagnnnntaggtctcagatagcaacgaacgtgaccgtactctattgttgcagtaacatatacgcctaaccaacgtataaaccactgcttagtgtgacgctgcgtcttaccaacgcgcgacacacattaaactatagagaccgctgattcttctttaaaccagaggaaggatacsgcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcacgattttgaatatgtgccttggtacgtattcatatatctgttgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacattatatgtacgcgcaagtctatccggcccgcctttgtgcgtggtgcagtgtatagcttgttgtttcgtacgtgccacttacgtattaattcatacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatatcatcatagtagaatctataggactgccaaacctttgtgctcgcacacgggttagtggaaatatatatgaatagtgtgatctaaaggaaggagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 1404 | genomic DNA | 1404 | marine sediment | taxon:998787 | 8 | Israel:Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgnnggagcatgtggcttaatttgactcaacacgggaaatcttaccgggtccggacacactgaggattgacagatatacgttgcgtgagctctctttgggggccgacgcaactgaaagatgctagttctttcacgattatgtgataggtggtgcatggccgttcttagttcgcggagtgatctgtctgcttaattgcgtatcaataatagagacctactatacgcgtagaaccgtatggtttgtgaccccctccctcgcggaggcgtgtgtcgcacatacgttatacgcataggtctcagatagcmaacgaacgtgaccgtactctattgttgcagtaacatatacgcctaaccaacgtataaaccactgcttagtgtgacgctgcgtcttaccaacgcgcgacacacattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcacgattttgaatatgtgcctcggtacgtattcatatatctgttgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacattatatgtacgcgcaagtctatccggcccgcctttgtgcgtggtgcagtgtatagcttgttgtttcgtacgtgccacttacgtattaattcatacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaacctttgtgctcgcacacgggttagtggaaatatatatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI