Specimen 1405

Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T8
Isolate number 1405
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on June 1999
Habitat soft sediment
Location Gulf of Eilat, Taba, Israel

Barcode sequence

SSU partial

>Ammonia sp. 1405 | genomic DNA | 1405 | marine sediment | taxon:155775 | 11 | true | Israel:Taba | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcntgtggcttaatttgactcaacacgggaaatcttaccgggtccggacacactgaggattgacagatatacgttgcgtgagctctctcgggggccgacgcaactgaaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcaataatagagacctactatacgcgtaaaaccatatggtttgtgaccccctcgttaagaggcgtgtgtcgcacatatgtgttatacgcataggtctcagatagcaacgaacgtgaccgtactctattgttgcagtaacatatacgcctaaccaacgtataaaccactgcttagcatatagctgcgtcttaccaacgcgcaatatgcattaaactatagagaccgctgtttcttctttaaaccagaggaaggatacggcaataacaggtctgtgatgccctcagatgttccgggctgcgcacgtgctacaatgatcattgcactgtgcatctaacccaatgtgcgcggacgcacgattttgaatatgtgcctcggtacgtattcatatatctgttgcgaccgcgccgaacctacttcgaaagtaaaatttctcagtgggtaatccattagaagtaatgactcgcatagaccatggcacattatatgtacgcgcaagtctatccggcccgcctttgtgcgtggtgcagtgtatagcttgttgtttcgtacgtgccacttacgtattaattcatacgtggggacagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacntccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgaatctataggactgccaaaccttcgcttgcgagggttagtggaaatatgtatgaatagtgtgatctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. 1405 | genomic DNA | 1405 | taxon:155775 | 9 | single cell | true | Israel:Taba | 28S rRNA | 28S rRNA | 28S ribosomal RNA cgtaataacagaaactaaccaggattcccttagtaacggcgagtgaactgggataccaatataaaatatgcactatgtgcataatttagcccgtcgatactatcctagcatattaccggtctcggccggtaaccaaatatgcgggaattgtagcatcgtaatatttatatacgtataacctacgcacacacacacatacctaaccgccaatatgtttctacgtactaggcaccttgtaaacacacagcgtctccgcgttggaaagcaagtatatatcctctttggatatgccatagagtgtgacagccacgtttgaatcactcgcccatagtacgcgtataacatacacacacacatacacccaatggcgcgccggcagtgcagtgcacgtaaccatactgtatatatataacctgagtcgagttattt

See sequence on NCBI