Specimen 607

Species Rotaliida > Rotaliidae > Ammonia > Ammonia sp. T9
Isolate number 607
Collector Jan Pawlowski
Identifier Maria Holzmann
Habitat salt marsh
Location USA, New York, Long Island

Barcode sequences

SSU partial

>Ammonia sp. 607 | genomic DNA | 607 | marine sediment | taxon:998794 | 13 | USA:Long Island, New York | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacattcatgcgntattatatcgtcggtgtaacgcaaataaatatgctagttctttcatgattatgtgataggtggtgcatgggccgttcttagttcgtggagtgatctgtcctgcttaattgcgtatcgtattaagtaggccatattatgtggggatcntctgcngccatngacccctcaacttcttagttgtagcgcgtgtcatgcgtacgatctcacttggccttatcgatagcaacngaacgtgaccgtattnctattgttgcagtgaaattcttaccactgcattgtgtgatacttttagtattgcacgtaaactantagagaccgctgtttctttcttaaaccagaggaaggttacggcaataacaggtctgtgatgccctcaaatgttccgggctgcacacgtgctacaatgatcattgcattgtgcatctaacccaatagtgtgtctagctcagcttacatgttgccttcgggtgatatgtaatgcgtgagcttggacgcctgaacctacttcgaaagtaaattttagtgggcaatctattagaagtaatgactcgcatttagaccaaaggcaacttatatgtacgcacatgcttagccggctcacctttgtgtgagtgcagtgcctaacatgttgttcgtacgcctatcgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgagtatgtaggactgtacgtgaccgtgaaaaatttatttttcactcaccatggaaatatacacgaatagtgtgatctannnnnnnaagagagaantcgaacaaggca

See sequence on NCBI

SSU partial

>Ammonia sp. 607 | genomic DNA | 607 | marine sediment | taxon:998794 | 15 | USA:Long Island, New York | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggantgacagacattcatgagttgttgcctcggcgcaactcatacaaatatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtatcgtattaagtaggccatatacgtgggatctctgcgccatgacccctcaacttctcagttgtagcgcgcgtcatacgtacgaatctcacttggcctatcgatagcaacgaacgtgaccgtattctattgttgcagtgaaattcttaccactgcattgtgtgatacttttagtgttgcacgtaaactatagagaccgctgtttctttcttaaaccagaggaaggttacggcaataacaggtctgtgatgccctcagatgttccgggctgcacacgtgctacaatgatcattgcattgtgcatctaacccaatagtgtgtctagctcagcttgcatgttgcttgcaatatgcaatgcgtgagcttggacgcctgaacctacttcgaaagtaaatnntagtgggcaatctattagaagtaatgactcgcatttcagaccaaaggcaacttatatgtacgcacatgcttagccggcttacctttgtgtgagtgcagtgcctaacatgttgtctcgtacgcctatcgtattaattcatacgtggggatagatcattgtttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacataccactcggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggattatactatgagtatgtaggactgtacgtgaccgtgaaaaatttatttttcactcaccatggaaatatacacgaatagtgtgatctaaaggnannngaagtcgaacaaggca

See sequence on NCBI

Other sequence

LSU partial

>Ammonia sp. Ammp1 | genomic DNA | Ammp1 | taxon:155588 | 37 | true | USA:Long Island, New York | 28S rRNA | 28S rRNA | 28S ribosomal RNA gagtcgagttatttgggactatagctcaaatagtttggttggtggtaatgacacatcaaaggctaaatattggttagtcgatgcaactttatacggagaccgatagcatacaagtaccgtaagggaaagatgaaaagcaccctattgagttcacgccgtcttagaaattatggcctcggccacttttcttatgacgcgcatacaactacagtgggagtgaaagagagagtgaaatcgcctatacgtgaaaatataaaatacacgcaacaacgtactgtattctatatagtctgcgatagtacaatcggacagagtgtggcattaacggccgtctgacttattctctcacactcagtgggtaagttatgattggcccatggttgatttttacaatcttccatacgcgacacaactgtacgacccgtcttgaaacacggaccaaggagttcaactggattacgagtcgtagcgttataatatataataagcgcatacggcatagcgaaagcaaacttatattactgtgccaggtcagccttaccgaggcttgtccgcagcacgcgctgagttagaatatacgtcggccgtaaggaaggcgtataccatataatttattatgtgggtaactcaagcgttcaacatcgagtacatcttgttgagacccgaaagatggtgaactatgcttggatatggcgaagtcaggtgaaaacttgatggaagcttgcgttgtgcggaactgacgtgcaaatcgttaccgcctaacctaagtataggggcgaaagactcatcgaaccatctagtagctggttccctccgaagtttccctcaggatagc

See sequence on NCBI