Specimen 13131

Species Textulariida > Incertae sedis > Eggerella > Eggerella sp.
Isolate number 13131
Collector Jan Pawlowski
Identifier Maria Holzmann
Collected on January 2010
Location Gulf of Eilat, Israel

Barcode sequences

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 13 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggtttaatttgactcaacgcgagagatcttactgggtccgtacacactgaggattgacaggcaatattaaaaaaattgaatatatttaattatatattttaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttatatttataatacgtgtgttgacggcactttgtcccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 16 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgagaaatcttactgggtccgtacacactgaggattgacaggcaatattaaaaaaattgaatatatataagtttatatatttaatttttatatgaaaatatgcgacctttttcnnnntatgagaaagggggcgnagcgccgctcatgattnnnngagagatctgtctctttaattgcgtttcactaagggctttatttataacacgtgtgggacggcactttgacccttttgttgcagtaaaatatatgngataaatatgtgcgtgtcttagtattgagcttagtctcgcacaaatgagtcctgaaagcaacgaaacgagaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggaccgctgtactctttttaaaccagaagaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagagagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 14 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggcttaatttgactcaacgcgagaatcttactgggccgtacacactgaggattgacaggcaatattaaaaaaattgaatatatttaattatatattttaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggcttatattttataatacgtgtgttgacggcactttgacccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgagtcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggaccgctgtaatctttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatcctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Eggerella sp. 13131 | genomic DNA | 13131 | marine sediment | taxon:998800 | 15 | Israel:Elat | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagatgtggttaatttcactcaacgcgagaaatcttactgggtccgtacacactgaggattgacattcaatattaaaaaaattgaatatatttaattatatattttaatttttttatgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgtttcttagttcgtggagtgatctgtctgctttaattgcgtttcactaagggcttatatttataatacgtgtgttgacgggcacttttgacccctttatgttgcattgaaatatatgtgatataaatgtgcgtgtcttagtatttagcttagtctcgcacaaatgtagtcctgaaagcaacgaacgtgaccgcaacctcttgttgccttttcaattacacaacattttaacattttatatgttattatgttaaaaaaaaggcctttaaactagagggacccgctgtaatctttttaaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccggggctgcacacgtgctacaatgattattgcagtgagcatcccattttttacacactgtagtgcgagtccatttattgacttaacattcacgttaatgtactttaaatgtgttactttgcgcacagtaaagcctgcttcgaaagtaagtgggtaatcaattagaagtaatgatttcccgtaaatataaatttattttatatttaatagcacacatatatacggcatctttacccaacgcacagcttgtctgtcgttttgtgtgtattgatgtaacaattttccgtatgtgcaattgtcaattcatggtggggacagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttaatttattaataattaaatttatttaattttaatatcctctggaaacttaaacgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI