Specimen A53

E. aculeatum A53 E. aculeatum A53 E. aculeatum A53 E. aculeatum A53
Species Rotaliida > Elphidiidae > Elphidium > Elphidium aculeatum
Isolate number A53
Collector Loic Pillet
Identifier Loic Pillet
Collected on August 2007
Habitat Macro algae
Depth 0
Location English Channel, Trebeurden, France
Latitude, Longitude 48.7878, -3.5823

Barcode sequences

SSU partial

aagggcaccacaagaacgcgcggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattacttcattaagtatctaatctttatgtatcgtacctctgtgtatgttcaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatatttttatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatgcgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttatgtatcgtacctctgtgtatgttcaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatatttttatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

Other sequences

SSU total

>Elphidium aculeatum | genomic DNA | A53.1 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA ctcaaagattaagccatgcawgtggttattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttaactaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcaccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatatctattgaggcagtgataagctgtaacggttgagtattaatctaatttgacgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgtttttatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatatttttattatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtactatatacattattatacaatacacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgcagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgcggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattacttcattaagtatctaatctttatgtatcgtacctctgtgtatgttcaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatatttttatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatgcgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI

SSU total

>Elphidium aculeatum | genomic DNA | A53.2 | taxon:46086 | SSU | SSU | small subunit ribosomal RNA tattttttaataaccctatcagtttaaatatacgcgcaagcgtacatgcaactgcagacagctgcttaatacagtcacacttgtcttgactcggtttaactaatttacgaacaacggataactcagggaaagtttggctaatacgtacgaacaattattattgcatacagttacgcatgaatgagattgtatacgtgcgcgtgcttgcgccgcacacggcagatattgtgtatttataacacgatacatgtcatacaagcatctatagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcactgtacattgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaataatagtacaaaaacacagtgaacatttctagctctcatatatctattgaggcagtgataagctgtaacggttgagtattaatctaatttggcgtgtatctggcatgcgttatacgtttacgcgtatattactgcatacgccgatactatgtgtgctcagtctggaatgcggtgagtctaaacaactcagaacctacgtttttatacgtgtatctgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactaaatattttatatatttacaacactgtgatcaaatcagcatgtatcacgtatgtattactaatacacgcattgtatgtttattcatggaatgttgctctgtattttattatacaattatacgtcgatggggatagttggagtcaacagtactagtaggcgagcggtgaaatgcattgaccctaccaagactaccaaaagcgaaagcagttgtctaggctatattctttgtacttgtactatatacattattatacaatacacacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattttatacatcaaacgatgggttctcactcgaccaaaaatacatatcaagacttgtagtacatacttctgtactcgtctatattactgattttctaagctttgcgctcaattttatacggtgagatgtaagtaatggctgtatctttatgatgcatgctatattatgatgcacgtattaggcatgcgcttactgcagaaatgtctgagatattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacagacaaacacatttatgtgttataaagatgctagttctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcaatattttattacgtatacgtatgaccaacttacctttaccggtatgtttgtgtctagtatgctatcatttgaaagcaacgaacgtgaccgtatccttttattatgtacgcacgcgtatatttatttcattaaagggaccgctgtttctttctttaaaccagaggaaggttacggcaataacaggtctgtgatgcccttcgatgttccgggctgcacacgtgctacaatgattatttcattaagtatctaatctttatgtatcgtacctctgtgtatgttcaaaatacctaccctgagaatgggcgggtaatcaattagaagtaatgatttcctttttttaatacgcaactatgtaccgtatattacatcccacatatttttatatatgtgcgtgtgtgttttattaccgtgtacgcgtaactgttaattcatggtggggatagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtcattggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaacttcgctatgaatctattggactgtgctctcttatgagtgcggaaagatatatgaatagtgtggtttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacctgctgatggatcatta

See sequence on NCBI