Specimen 3604

Species Rotaliida > Incertae sedis > Hyalinea > Hyalinea baltica
Isolate number 3604
Collector Magali Schweizer
Identifier Magali Schweizer
Collected on May 2002
Location Oslofjord, Norway

Barcode sequence

SSU partial

aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatatcataatttatagtttatttacttcggtacttattctaatattatgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggtccataaatttatgtatgttgcgacgcattgacccctcatttaattatgagcgctgcgtctttgtcgtttagctcatgcgattggatcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacttttatatgctgcgtacagttaatcctgtatgtattgtactgtaattgtgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattcatacatcgcatgcgcgagtccatttattctgtgctttcgggcactgttttaaatgtgtatctctgcgcgcgataaagcctacttcgaaagtaagtgggtaatcaattagaagtaatgatttccttaatttatagcacacatatatacggcagctttacccagccagccttgttgctggatcttgtgtgtattgctgctttttccgtatgtgcaattgtcaattcatggtgggggcagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttcagggactggagttattttcaaccctatggaaactgaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatccagtaggtgaacct

See sequence on NCBI

Other sequence

SSU total

>Hyalinea balthica | genomic DNA | 3604 | taxon:203415 | small subunit ribosomal RNA ttaagccatgcaagtggttatatcaacccgacagtttaaataagtgttaaattgctacacattataaacgcaacattattcatctacatacagtgaatactttttacacagtatcacttacgcaactgcagacagctgcttaatacagtcacacttgtcttgacttggctattaaatattatgctatagcataaactgaactcacgcagtataatcgtatgctacaactacacacaaaaaaatgacatacgcgttctgtggaaggttagtgacctgcatagtaaatattaaaattaaaattgtttacaagctacgtacagtatctacgcagttgataccacacaacaactcactgcattttacgatctgtgcaagctgttttacaatgatttctctgtatcgcgttatacttacaagaacatgcgttacaccgtgacaaatttctttatggataactcagggaaagtttggctaatacgtacgagtatttttaaaacacactgtaattgtgtaacataattatctctctacaggcgagtgcataacagcgcttaacggcagaatgaattattattcagcactttctacaacaacatactactcagcactcaatggtaagctttggttttttacgttcgcgtaattaccagtttaaagtttaactgcaacatgagagacattgagcacgcacgtggtggggtaatttattcgtttcgccacatctacgctgagcagactttgcgaagtttactttgcgaagcatgtcatacaagcatctacagcatcaagtcacagggttggcaagtgtatttttgaaccttcaaagcagtcacgcatacggaagagtagtttctgatcccatagaaggagcaccgtacaatgagagaccgctcttagttctaaggaacgcagcaggcgcgtaaattgcccaatgctagtaccctacaaattacatagtattaatacaacaatttacaataaaacaagtttataaaacacgcacattataacacattatttcattctgtcctacagaatatcatacatatccttgttcgttgtaactcacgtaatttattttactgaggcagtgacaagctgtaacggttgagtataaaaatgacgagtgtctggcattgccgctctttcgggagcttggcaagttgccgacgctttgtgtgctcaattggaatgcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnccgcggtaataccagctccactggcctatacaatcattgttgcggttaagaggctcgtagttggattgaactacaatacatagaataataataaattctataagctagtttcgtacaaaaagtagcaatatatttgcagtacttactgttacagacactacatcacacacgaaacaacactgtgtctttcgtagctgcaagcctgtaaatagctatttttttacgtttcgacgcaccgtactaaattaatattattttattcatatagcttacggcaaccttgtaaataattacacacaaccaaatccattatttacgcggcagaattatactcgaattttttattctcctttcaacactgtgaacaaatcagagtgtatcaaacatgtcgtttttgaatgtgcattgaatgtcttatcatgggatgttgccttaattcaaacgcgttagaaatatttagctgtacgacagacatcacacacaaaccttacaatcactctgcgtactgttaatattatctaacacagtgccagtgacacatgaataatattttatatttctaacggttaaaaatgtcgatggggatagttggagtcaacagtactgctgggcgagaggtgaaattcattgaccctagcaagactaccaaaagcgaaagcagttggctaggctatactctttgtgattaactattcgtttgcagactctatgcgaagctttttaaacgctgctatacacacaaacattttcagcacgtactatagctattaacatacgagtcaaactcgcgaatacttatataacactttacaatgaagaacgaaggttgggggatcaaagaggatcagataccctcgtcgtcccattaattacatcaaacgatgggctctcaattgcattttacattaaattgcaaatttcctcagcctacaaaattactctggcttgagctcgtatttcgatacgctcgcctaatcaattttcgtacggtctctgatggacgtttcgtttaaaaatattttttgcgtgtaagcattgtattttatctttgaaacataagattatactgcgtgcacttgattttcggagctttgcgctcaattctggtgagatgtaagcatcatgtcattgctacccgcagtgtatatcttcgggtatttcatctgtcgtgcgtagctgacactttttcgatgtgaagcacgctttaggcacgcgcttactgcagaaatgtctgagacattcccctccgggggtagtatgcacgcaagtgtgaaacttgaaggaattgacggaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaatatcataatttatagtttatttacttcggtacttattctaatattatgtgttaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcactaagggtccataaatttatgtatgttgcgacgcattgacccctcatttaattatgagcgctgcgtctttgtcgtttagctcatgcgattggatcctgaaagcaacgaacgtgaccgcaacctcttgttgcctttataccaaacacttttatatgctgcgtacagttaatcctgtatgtattgtactgtaattgtgcaaaaaggctttttaaactagagggaccgctgttactttcttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcatattcatacatcgcatgcgcgagtccatttattctgtgctttcgggcactgttttaaatgtgtatctctgcgcgcgataaagcctacttcgaaagtaagtgggtaatcaattagaagtaatgatttccttaatttatagcacacatatatacggcagctttacccagccagccttgttgctggatcttgtgtgtattgctgctttttccgtatgtgcaattgtcaattcatggtgggggcagaccattgttaattgttggtctcggtcttaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttcagggactggagttattttcaaccctatggaaactgaaacgaacagtgtggtctaaaggaaagagaagtcgtaacaaggcatccagtaggtgaacct

See sequence on NCBI