Specimen 10144

Species "monothalamids" > Clade O > Cedhagenia > Cedhagenia saltatus
Isolate number 10144
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.29, 33.35

Barcode sequences

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10144.3 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaaccttaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagcttacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgacgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggctcttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacatgccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttcggatgtgtatgactatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI

SSU partial

>Foraminifera sp. JP-2010b | genomic DNA | 10144.1 | sediment sample - Tile Hole | taxon:860580 | Ukraine:Black Sea, Balaclava Bay | 44.29 N 33.35 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Cedhagenia | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcaagtggcttaatttgactcaacgcgggaaacctcaccgggtccggacatactgaggattgacaggcaaataatagttatactttttgtatagctaacttaccaaatatgtaagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagatatatggggttctaaggtattacgacgtaaggtgcttcggtacacttgcttagtagcctgcccctttgaaagcaacgaacgtgacctcaaacctatgttacctctttttattatagaggctatcttaggtgactgccagagttgtcaactcggaggaaggttgaggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattgttgcagtaagtatctgactgctcttatactgtgtttgtacttcggtacatcaacacagtgggttttacccttcggggtattactcatagacctacctcgaaagtacggtaggcaatcaattccaagtaacaatctacctattttataggaaagcacaagcctaaagactttgtttgtaattgcttcggcttttgcaacttggtcgtgctctaattgaattcgtggtcgggacagaccattgtgcttaattattggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacataccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggactactctgtgagttggagggactggccatccatatatgcttcttgggatgtgtataggctatagaaactcctgcgaacagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI