Specimen 10110

Species "monothalamids" > Clade E > Psammophaga > Psammophaga sp.
Isolate number 10110
Collector Andrew Gooday
Identifier Andrew Gooday
Collected on June 2008
Habitat soft sediment
Depth 5-10m
Location Black Sea, Crimea, Balaclava Bay
Latitude, Longitude 44.33, 33.24

Barcode sequence

SSU partial

>Psammophaga sp. 10110.12 | genomic DNA | 10110.12 | sediment sample - Tile Hole | taxon:859213 | Ukraine:Black Sea, Kazach'ya Bay | 44.33 N 33.24 E | Jun-2008 | J.Pawlowski | fwd_name: s14F1, fwd_seq: aagggcaccacaagaacgc, rev_name: sB, rev_seq: tgccttgttacgacttctc | Classification: Eukaryota, Rhizaria, Foraminifera, Psammophaga | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcgtttgtggtttgctttctgctctcgttagtaggaagctttccactataaatatgctagtcctttcatgattgtgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcacaaagaactctttaacttttgcctgttgcgcggcattcgctgctctttaatgagccggtgtcagtgcacggtgaagaaaaagttctgaaggcaacgaacgtgaccgcaacctcttgttgcctccttctccattgttgagacatggttcttgtttgatgcttccccgcactttattgtgtgttggctcagcttgacctgcatggagtgcgaactagagggaccgctgataacctttaaaacagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctaactttaaaacggttcgagcttgtgtttgcgtgtctgggttcgctcagttcgcttacatggtttgacctatcgacctgcttcgaaagtaagcaggtaatcaattcgaagtaatgatttcctttcgcacatacttatatctcttgcttgcgggctagcctgtccttgtggcatggttttgttttcgccttgagatatgtgctccattaattcatggtggggacagaccattgttaattgttggtctcggtctcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatatgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctatgagtttggaggactggacgtctacttgctagttagatatctatggaaatctaaacgaatagtgtggtctaaaggaaagagaagtcgaacaaggca

See sequence on NCBI