Specimen 5174

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 5174
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4526m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -70.31, -14.34

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 5174 | depth 4526m, using a vegematic boxcorer | taxon:558411 | 1 | Antarctica:Southern Ocean, Weddell Sea | 70.52 S 14.58 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttctttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccctagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtcttttgtgagcctkgtatttctttttttagtttatacatctcagttngnctkcgttttatgggagtgtgtttgtctttttatatttattccgcttttngcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgntaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtcyaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 5174 | depth 4526m, using a vegematic boxcorer | taxon:558411 | 3 | Antarctica:Southern Ocean, Weddell Sea | 70.52 S 14.58 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtttcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggkgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccacatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI