Specimen 6668

Archaias angulatus 6668
Species Miliolida > Soritidae > Archaias > Archaias angulatus
Isolate number 6668
Collector Jan Pawlowski
Identifier Jan Pawlowski
Collected on September 2006
Habitat Reef sediment
Location Brazil, Maracajau Reef

Barcode sequence

SSU partial


See sequence on NCBI

Other sequence

SSU total

>Archaias sp. 6668 MH-2008 | genomic DNA | 6668 | marine sediment sample | taxon:577497 | Brazil:Natal | 25-Sep-2006 | 18S rRNA | 18S rRNA | 18S ribosomal RNA tactaatgcaactgcgaatagctgtttaatacagtcgcaattgtattgacttagcatatatagaaaataataatagttatatttggataactaagggaaagtttggctaatacgttttttgtattaataatacatatgcatataataatattgcaacatgatagatattatataaataataaatagtatttatttagtatagagtggactttataatatattatataattataaagcatgtcaaacaagcatctatagcatcaagtcacaatgttggcatgtgtattattgaaccttcaaagcatttacgcattcggaggagtagtttctgatcccgtcgaaggtgcctgagagacggcacttagttctaaggaacgcagcaggcgcgtaaattgcccaatgacaaaacatgttatgttattattaaacttaatatattatatattgaggcagtgacaagctgtaaagattcaatatattaattaagataacatttggaattgtccctttataatattttatattattttggttgataatataccaatgttataaaatattgaatttgaatgcggtgaatataataatttcaagtaacatgtataaaatgttttaattttatatgttattcgaattttcaagtggagggcaagtctggtgccagcagccgcggtaataccagctccactagcttatacaatcattgttgcggttaagaggctcgtagttggattgaataaaatatattatatataatatacaatactgtgaacaaaccagagtgtataaaacatgtaatatttttaattattagcaatgaatgttttatcatgggatattgctaatatatgtcgatggagatagttggagttaagagtactgataggcgagcggtgaaatgcattgaccctatnaagactaacaaaagcgaaggcacttaactagattattctctttntattattacaatgaagagcgaaggttgggggaacaaagaggatcagataccctcgtagtcctattttttacatcaaactatgggatttcaattgaataaattattctctcaactaataattaaaaatgattgagtgtaattatttaatatactctcatttataattatacatgttgatattacacactatgattatatgtactttgggctcatataattatataggtgagatgtaagcattatagatgattaatatatttactacatattgtaaatattattataattctaaataaaaatgtaatgtgatgcacgttttaggtacgagcttactatagaaatatttaaaataataccctcctggggnagtatgcacgcaagtgtgaaacttgaaggnnnnnnnnnaagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttaccaggtccagacatattgaggattgacaggcgatagtatatattatatattatatataatatatgcataaaaatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatttgtctgcttaattgcgtttcagttaaataaaatatataatatacattaatattttagttctgccagcaatggatttaaagtgaacatattattgttattaatatataataaatgaatgcaacgaacgtgaccgtaaccttttattgctataataattattaatatagcttaaaattaaagggaccgctgtcattattatatgtgttaaaatagagtaagattacggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaataattacattaataagtatatatattaatataacatcatgtatgttatacacttaaacctatttcgaaagtaaatgggtaatcatttaaaaatcgtgattatatttaatttaaggtggggatagtgtattgttaattattacacttggccttaactaggaatgccttgtactcttctttggtttaacataccaagaggaatacgtccctgccctttgtacacaccgcctgtcgctcttaccgatgaattatattataaatctaagggatataaaactctagggtatatcaaacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcagtaggtgaacct

See sequence on NCBI