Specimen 365

Species Miliolida > Alveolinidae > Borelis > Borelis schlumbergeri
Isolate number 365
Collector Maria Holzmann
Identifier Maria Holzmann
Collected on January 1997
Habitat Reef sediment
Location Gulf of Eilat, Israel

Barcode sequence

SSU partial

>Borelis schlumbergeri | genomic DNA | 365 | marine sediment sample | taxon:128061 | 16 | Israel:Elat | Jan-1997 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaacgcgggaaatcttatcaggtccagacatattgaggattgacaggcgataacatataataatattttatatattattatatgtataaacatgatagtcctttcatgattatatgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcagattatattaacaataatatatattataatatttttatatagttctgctcctatttttagtgagattgtgaacatatattttattatatatatattatttattaaatgaatgcaacgaacgtgactataaccttttattgctatatatttatttaaaatatattaattactttggtattaatatataatatagcttaaaattaaaggaaccgctgtctattttaagtgcttaaaacagagtaagattatggcaataacaggtctgtgatgccctcagatgttctgggctgcacacgtgctacaatgatcacactaataagtgtctaattaaacaaatagtatttattttaatatatattatatattttcttataatatatattatttataaatctatataaaacctatttcgaaagtgaatgggtaatcatttaaaaatcgtgacaaattatatttatactacattatataaatattattatattaatagaataattatattcaattatctcttattaattaataatatttgtagtattaattaattcatggtggggatagtgtattgttaattattacacttggctttaactaggaatgccttgtactgttccttggttcaacataccaacaggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatgaattatattataagtctaagggacttaatacatatattctttttgaatatatatcaggaaacttatacgcataatgtgacttatatacataatgtgatttaaaggaaagagaagtcgtaacaaggcatcgtaggtgaacct

See sequence on NCBI