Specimen 8353

Species "monothalamids" > Clade C4 > Leptammina > Leptammina flavofusca
Isolate number 8353
Collector Tomas Cedhagen
Identifier Tomas Cedhagen
Collected on February 2005
Habitat soft sediment
Depth 4696-4698m
Location Southern Ocean, Weddell Sea
Latitude, Longitude -64.58, -43.0197

Barcode sequences

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8353 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 9 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatcttaccgggtccggacacactgaggattgacaggcaattattgctaacagtgtcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggkggkgcatggccgttcttagttcgkggagkgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcgcacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttataaatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgnacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI

SSU partial

>Saccaminidae sp. JP-2008a | genomic DNA | 8353 | depth 4696-4698m, using an epibenthic sledge | taxon:558411 | 8 | Antarctica:Southern Ocean, Weddell Sea | 64.98 S 43.03 E | Feb-2005 | 18S rRNA | 18S rRNA | 18S ribosomal RNA aagggcaccacaagaacgcgtggagcatgtggcttaatttgactcaaccgggaaatctttccgggtccggacacactgaggattgacaggcaattattgctaacagtgtcttttttttttaaaagtactgttgcaacaacaaatatgctagtcctttcatgattatgtgataggtggtgcatggccgttcttagttcgtggagtgatctgtctgcttaattgcgtttcattatggaccatgttataacatgtactatctcttgattttcaaattttcatttatttgagatttgttataaagaaggagttttggtgcaattggtcctgaaagcaacgaacgtgaccgcatcctcttgttgcctttttaacttggcattttttttaatttattttaacatttttgtcataacataagaggctttcagaaaactagagggaccgctgcgacttttttaaaccagaggaaggttgcggcaataacaggtctgtgatgcccttagatgttccgggctgcacacgtgctacaatgattattgcagtgagcatctcattttattttttgtgcttgtcttgtctgcgagtttattctcaacgacgacagccttagcctgcttcgaaagttcgcaggtaatcaattggaagtaatgatttccctttctctttttttattacatttattttgtgatttctttaattaagcgagcacacaatatgctgctctctcgccctgtctttttgagcttgtatttctttttttagtttatacatctcagtttgactgcgttttgtgggagtgtgtttgtctttttatatttattccgctttttgcatttttattaatgtatattagtgtctatattttataatagcagctttcagcatgtgctttttgttaattcaaggtggggacagaccattgttaattgttggtctcgtttcaactaggaatgccttgtacgggtctttggttcaacaaaccacccggaatacgtccctgccctttgtacacaccgcccgtcgctcttaccgatggacttctctgtgagtttgagggactgggttgcagttttttttatattctgcaaacacctacggaaacttaaacgaacagtgtggtctaaaggaaagagaagtc

See sequence on NCBI